STAR Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

STAR Polyclonal Antibody

ABP60534-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STAR protein
  • Applications tips:
Description: A polyclonal antibody for detection of STAR from Human, Mouse, Rat. This STAR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAR protein

STAR Polyclonal Antibody

ABP60534-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STAR protein
  • Applications tips:
Description: A polyclonal antibody for detection of STAR from Human, Mouse, Rat. This STAR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAR protein

STAR Polyclonal Antibody

ABP60534-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STAR protein
  • Applications tips:
Description: A polyclonal antibody for detection of STAR from Human, Mouse, Rat. This STAR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAR protein

STAR Polyclonal Antibody

A61174 100 µg
EUR 570.55
Description: kits suitable for this type of research

Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit

DLR-STAR-Hu-48T 48T
EUR 517
  • Should the Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Steroidogenic Acute Regulatory Protein (STAR) in samples from tissue homogenates or other biological fluids.

Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit

DLR-STAR-Hu-96T 96T
EUR 673
  • Should the Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Steroidogenic Acute Regulatory Protein (STAR) in samples from tissue homogenates or other biological fluids.

Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit

RD-STAR-Hu-48Tests 48 Tests
EUR 521

Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit

RD-STAR-Hu-96Tests 96 Tests
EUR 723

Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit

RDR-STAR-Hu-48Tests 48 Tests
EUR 544

Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit

RDR-STAR-Hu-96Tests 96 Tests
EUR 756

STAR Rabbit pAb

A1035-100ul 100 ul
EUR 308

STAR Rabbit pAb

A1035-200ul 200 ul
EUR 459

STAR Rabbit pAb

A1035-20ul 20 ul
EUR 183

STAR Rabbit pAb

A1035-50ul 50 ul
EUR 223

STAR Rabbit pAb

A16432-100ul 100 ul
EUR 308

STAR Rabbit pAb

A16432-200ul 200 ul
EUR 459

STAR Rabbit pAb

A16432-20ul 20 ul
EUR 183

STAR Rabbit pAb

A16432-50ul 50 ul
EUR 223

Polyclonal STAR Antibody (Center)

APR10929G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAR (Center). This antibody is tested and proven to work in the following applications:

STAR Polyclonal Antibody, Biotin Conjugated

A61175 100 µg
EUR 570.55
Description: fast delivery possible

STAR Polyclonal Antibody, FITC Conjugated

A61176 100 µg
EUR 570.55
Description: reagents widely cited

STAR Polyclonal Antibody, HRP Conjugated

A61177 100 µg
EUR 570.55
Description: Ask the seller for details

STAR Antibody

ABD6192 100 ug
EUR 438

STAR Antibody

43333-100ul 100ul
EUR 252

STAR Antibody

32129-100ul 100ul
EUR 252

STAR antibody

22510-100ul 100ul
EUR 390

STAR antibody

70R-20565 50 ul
EUR 435
Description: Rabbit polyclonal STAR antibody

STAR antibody

70R-12924 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal STAR antibody

STAR Antibody

DF6192 200ul
EUR 304
Description: STAR Antibody detects endogenous levels of total STAR.

STAR Antibody

1-CSB-PA226492
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STAR. Recognizes STAR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:40-1:150

STAR Antibody

1-CSB-PA174690
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STAR. Recognizes STAR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

STAR Antibody

1-CSB-PA022798GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAR. Recognizes STAR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

STAR Antibody

1-CSB-PA022798LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAR. Recognizes STAR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STAR Conjugated Antibody

C43333 100ul
EUR 397

STAR Conjugated Antibody

C32129 100ul
EUR 397

anti- STAR antibody

FNab08288 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: steroidogenic acute regulatory protein
  • Uniprot ID: P49675
  • Gene ID: 6770
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against STAR

Anti-StAR Antibody

A00051-1 100ug/vial
EUR 294

Human STAR Antibody

32172-05111 150 ug
EUR 261

Anti-STAR antibody

PAab08288 100 ug
EUR 355

Anti-STAR antibody

STJ25713 100 µl
EUR 277
Description: The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13.

Anti-STAR antibody

STJ118872 100 µl
EUR 277

Anti-STAR antibody

STJ191473 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STAR

Star/ Rat Star ELISA Kit

ELI-52127r 96 Tests
EUR 886

STAR siRNA

20-abx905318
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STAR siRNA

20-abx935404
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

STAR siRNA

20-abx935405
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

WESTSAVE STAR

LF-QC0106 1kit
EUR 171
Description: Abfrontier WESTSAVE STARTM (Western Blotting Substrate) is enhanced luminol-based chemiluminescent substrate for the non-radioactive detection of Horseradish Peroxidase(HRP) labeled antibodies.

WESTSAVE STAR

LF-QC0107 1kit(Double pack)
EUR 270
Description: Abfrontier WESTSAVE STARTM (Western Blotting Substrate) is enhanced luminol-based chemiluminescent substrate for the non-radioactive detection of Horseradish Peroxidase(HRP) labeled antibodies.

WESTSAVE STAR

LF-QC0108 1kit (200 ml)
EUR 270
Description: Abfrontier WESTSAVE STARTM (Western Blotting Substrate) is enhanced luminol-based chemiluminescent substrate for the non-radioactive detection of Horseradish Peroxidase(HRP) labeled antibodies.

STAR Antibody, HRP conjugated

1-CSB-PA022798LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAR. Recognizes STAR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STAR Antibody, FITC conjugated

1-CSB-PA022798LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAR. Recognizes STAR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STAR Antibody, Biotin conjugated

1-CSB-PA022798LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STAR. Recognizes STAR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC552140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF555 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC552140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF555 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC552154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF555 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC552154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF555 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC612140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF660R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC612140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF660R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC612154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF660R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC612154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF660R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC402140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF640R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC402140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF640R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC402154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF640R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC402154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF640R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC472140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF647 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC472140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF647 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC472154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF647 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC472154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF647 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC052140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF405M conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC052140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF405M conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC052154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF405M conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC052154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF405M conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC042140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF405S conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC042140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF405S conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC042154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF405S conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC042154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF405S conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC432140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF543 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC432140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF543 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC432154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF543 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC432154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF543 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNUB2140-100 100uL
EUR 264
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Concentration: 0.2mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNUB2140-50 50uL
EUR 405
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), 1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNUB2140-500 500uL
EUR 513
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Concentration: 0.2mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNUB2154-100 100uL
EUR 264
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Concentration: 0.2mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNUB2154-50 50uL
EUR 405
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), 1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNUB2154-500 500uL
EUR 513
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Concentration: 0.2mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC682140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF568 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC682140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF568 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC682154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF568 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC682154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF568 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC702140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF770 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC702140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF770 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC702154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF770 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC702154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF770 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC882140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF488A conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC882140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF488A conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC882154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF488A conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC882154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF488A conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC942140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF594 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC942140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF594 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC942154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF594 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC942154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF594 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNCB2140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Biotin conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNCB2140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Biotin conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNCB2154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Biotin conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNCB2154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Biotin conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNCH2140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNCH2140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNCH2154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNCH2154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC802140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF680 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC802140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF680 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC802154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF680 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC802154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF680 conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNCP2140-250 250uL
EUR 394
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), PerCP conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNCP2154-250 250uL
EUR 394
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), PerCP conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNCA2140-250 250uL
EUR 394
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), APC conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNCA2154-250 250uL
EUR 394
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), APC conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNCAP2140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNCAP2140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNCAP2154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNCAP2154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC812140-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF680R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNC812140-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF680R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC812154-100 100uL
EUR 233
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF680R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNC812154-500 500uL
EUR 545
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF680R conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody

BNCR2140-250 250uL
EUR 394
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), RPE conjugate, Concentration: 0.1mg/mL

StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody

BNCR2154-250 250uL
EUR 394
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), RPE conjugate, Concentration: 0.1mg/mL

Human STAR Antibody (Biotin Conjugate)

32172-05121 150 ug
EUR 369

StAR MonoSpecific Antibody, Unconjugated-20ug

6770-MSM3-P0 20ug
EUR 233

StAR MonoSpecific Antibody, Unconjugated-100ug

6770-MSM3-P1 100ug
EUR 428

STAR cloning plasmid

CSB-CL022798HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 858
  • Sequence: atgctgctagcgacattcaagctgtgcgctgggagctcctacagacacatgcgcaacatgaaggggctgaggcaacaggctgtgatggccatcagccaggagctgaaccggagggccctggggggccccacccctagcacgtggattaaccaggttcggcggcggagctctctact
  • Show more
Description: A cloning plasmid for the STAR gene.

STAR Blocking Peptide

DF6192-BP 1mg
EUR 195

pCMV-SPORT6-STAR

PVT13966 2 ug
EUR 391

Anti-StAR (5F9)

YF-MA15633 200 ul
EUR 363
Description: Mouse monoclonal to StAR

Anti-StAR (2B5)

YF-MA15634 100 ug
EUR 363
Description: Mouse monoclonal to StAR

Anti-StAR (5F9)

YF-MA10885 100 ug
EUR 363
Description: Mouse monoclonal to StAR

StAR-related lipid transfer protein 7, mitochondrial Polyclonal Antibody

42392-100ul 100ul
EUR 333

StAR-related lipid transfer protein 7, mitochondrial Polyclonal Conjugated Antibody

C42392 100ul
EUR 397

Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig)

4-PAG512Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STAR (Met1~Cys285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR)

Steroidogenic Acute Regulatory Protein (STAR) Antibody

20-abx115857
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Steroidogenic Acute Regulatory Protein (STAR) Antibody

20-abx129239
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Steroidogenic Acute Regulatory Protein (STAR) Antibody

20-abx174649
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Steroidogenic Acute Regulatory Protein (STAR) Antibody

20-abx214068
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Steroidogenic Acute Regulatory Protein (STAR) Antibody

20-abx214530
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human STAR AssayLite Antibody (FITC Conjugate)

32172-05141 150 ug
EUR 428

Human STAR AssayLite Antibody (RPE Conjugate)

32172-05151 150 ug
EUR 428

Human STAR AssayLite Antibody (APC Conjugate)

32172-05161 150 ug
EUR 428

Human STAR AssayLite Antibody (PerCP Conjugate)

32172-05171 150 ug
EUR 471

Rat STAR shRNA Plasmid

20-abx985119
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine STAR ELISA KIT

ELI-13873b 96 Tests
EUR 928

Chicken STAR ELISA KIT

ELI-23667c 96 Tests
EUR 928

STAR ELISA KIT|Human

EF003282 96 Tests
EUR 689

Human STAR ELISA KIT

ELI-40909h 96 Tests
EUR 824

Mouse Star ELISA KIT

ELI-41707m 96 Tests
EUR 865

Human STAR shRNA Plasmid

20-abx954628
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STAR protein (His tag)

80R-2034 100 ug
EUR 322
Description: Recombinant human STAR protein (His tag)

Mouse STAR shRNA Plasmid

20-abx972905
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

STAR Recombinant Protein (Human)

RP030313 100 ug Ask for price

STAR Recombinant Protein (Rat)

RP231326 100 ug Ask for price

STAR Recombinant Protein (Mouse)

RP175898 100 ug Ask for price

Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), APC

4-PAG512Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STAR (Met1~Cys285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with APC.

Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), Biotinylated

4-PAG512Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STAR (Met1~Cys285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with Biotin.

Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), Cy3

4-PAG512Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STAR (Met1~Cys285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with Cy3.

Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), FITC

4-PAG512Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STAR (Met1~Cys285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with FITC.

Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), HRP

4-PAG512Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STAR (Met1~Cys285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with HRP.

Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), PE

4-PAG512Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STAR (Met1~Cys285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with PE.

Monoclonal STAR Antibody (monoclonal) (M01), Clone: 5F9

APR10253G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human STAR (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5F9. This antibody is applicable in WB, E

RNA-Binding Protein T-Star (KHDRBS3) Antibody

20-abx113355
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody

20-abx000970
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody

20-abx142247
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody

abx145266-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RNA-Binding Protein T-Star (KHDRBS3) Antibody

20-abx005088
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA-Binding Protein T-Star (KHDRBS3) Antibody

abx030741-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RNA-Binding Protein T-Star (KHDRBS3) Antibody

abx030741-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody

abx028894-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody

abx028894-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RNA-Binding Protein T-Star (KHDRBS3) Antibody

20-abx320740
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA-Binding Protein T-Star (KHDRBS3) Antibody

abx218434-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody

abx238288-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

RNA-Binding Protein T-Star (KHDRBS3) Antibody

abx234523-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody

20-abx301292
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Star 1kb DNA Ladder Express

BT10701 500µl
EUR 80
Description: High purity buffer for various PCR applications.

Star ORF Vector (Mouse) (pORF)

ORF058634 1.0 ug DNA
EUR 1572

STAR ORF Vector (Human) (pORF)

ORF010105 1.0 ug DNA
EUR 95

Star ORF Vector (Rat) (pORF)

ORF077110 1.0 ug DNA
EUR 506

STAR ELISA Kit (Human) (OKCD00508)

OKCD00508 96 Wells
EUR 831
Description: Description of target: Plays a key role in steroid hormone synthesis by enhancing the metabolism of cholesterol into pregnenolone. Mediates the transfer of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane where it is cleaved to pregnenolone. <p>Describes the metabolic pathway(s) associated with a protein.</p><p><a href='../manual/pathway' target='_top'>More...</a></p>Pathwayi: cholesterol metabolismThis protein is involved in the pathway cholesterol metabolism, which is part of Steroid metabolism._x005F_x005F_x000D_View all proteins of this organism that are known to be involved in the pathway cholesterol metabolism and in Steroid metabolism. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.064 ng/mL

STAR ELISA Kit (Human) (OKDD00547)

OKDD00547 96 Wells
EUR 975
Description: Description of target: The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.064 ng/mL

STAR ELISA Kit (Rat) (OKEH03717)

OKEH03717 96 Wells
EUR 779
Description: Description of target: Plays a key role in steroid hormone synthesis by enhancing the metabolism of cholesterol into pregnenolone. Mediates the transfer of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane where it is cleaved to pregnenolone. <p>Describes the metabolic pathway(s) associated with a protein.</p><p><a href='../manual/pathway' target='_top'>More...</a></p>Pathwayi: cholesterol metabolismThis protein is involved in the pathway cholesterol metabolism, which is part of Steroid metabolism. View all proteins of this organism that are known to be involved in the pathway cholesterol metabolism and in Steroid metabolism.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.182 ng/mL

STAR ELISA Kit (Human) (OKEH08162)

OKEH08162 96 Wells
EUR 1092
Description: Description of target: The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7

4-PAG512Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: STAR (Met1~Cys285)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with APC-Cy7.

StAR-Related Lipid Transfer Protein 4 (STARD4) Antibody

abx036005-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

StAR-Related Lipid Transfer Protein 13 (STARD13) Antibody

abx031158-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

StAR-Related Lipid Transfer Protein 13 (STARD13) Antibody

abx031158-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

StAR-Related Lipid Transfer Protein 6 (STARD6) Antibody

abx026468-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

StAR-Related Lipid Transfer Protein 6 (STARD6) Antibody

abx026468-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

StAR-Related Lipid Transfer Protein 13 (STA13) Antibody

20-abx013866
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

StAR-related lipid transfer protein 13 (STARD13) Antibody

20-abx325729
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

StAR-related lipid transfer protein 13 (STARD13) Antibody

abx330528-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody (HRP)

20-abx305445
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody (FITC)

20-abx305446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

STAR Rabbit Polyclonal Antibody