STK25 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

STK25 Polyclonal Antibody
ABP60540-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of STK25 from Human, Mouse. This STK25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250

STK25 Polyclonal Antibody
ABP60540-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of STK25 from Human, Mouse. This STK25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250

STK25 Polyclonal Antibody
ES10200-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against STK25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK25 Polyclonal Antibody
ES10200-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against STK25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

STK25 Rabbit pAb
A9726-100ul	Abclonal	100 ul	EUR 308

STK25 Rabbit pAb
A9726-200ul	Abclonal	200 ul	EUR 459

STK25 Rabbit pAb
A9726-20ul	Abclonal	20 ul	EUR 183

STK25 Rabbit pAb
A9726-50ul	Abclonal	50 ul	EUR 223

STK25 Polyclonal Conjugated Antibody
C31735	SAB	100ul	EUR 397

STK25 antibody
22448-100ul	SAB	100ul	EUR 390

STK25 antibody
70R-13091	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal STK25 antibody

STK25 Antibody
DF9883	Affbiotech	200ul	EUR 304
Description: STK25 Antibody detects endogenous levels of total STK25.

Stk25 antibody
70R-8797	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Stk25 antibody

STK25 Antibody
1-CSB-PA022842LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STK25 Antibody
ABD9883	Lifescience Market	100 ug	EUR 438

Polyclonal STK25 Antibody (C-term)
APR10930G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK25 (C-term). This antibody is tested and proven to work in the following applications:

STK25 Polyclonal Antibody, Biotin Conjugated
A54393	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

STK25 Polyclonal Antibody, FITC Conjugated
A54394	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

STK25 Polyclonal Antibody, HRP Conjugated
A54395	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Mouse Stk25 Antibody
abx028074-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mouse Stk25 Antibody
abx028074-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

anti- STK25 antibody
FNab08328	FN Test	100µg	EUR 585
Immunogen: serine/threonine kinase 25(STE20 homolog, yeast) Uniprot ID: O00506 Gene ID: 10494 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STK25

Anti-STK25 antibody
PAab08328	Lifescience Market	100 ug	EUR 412

Anti-STK25 antibody
STJ111804	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene.

Anti-STK25 antibody
STJ191358	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to STK25

STK25 siRNA
20-abx935467	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STK25 siRNA
20-abx935468	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-STK25
YF-PA17007	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to STK25

anti-STK25
YF-PA17008	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to STK25

STK25 Antibody, HRP conjugated
1-CSB-PA022842LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STK25 Antibody, FITC conjugated
1-CSB-PA022842LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STK25 Antibody, Biotin conjugated
1-CSB-PA022842LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Stk25 Blocking Peptide
33R-9142	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Stk25 antibody, catalog no. 70R-8797

STK25 Blocking Peptide
DF9883-BP	Affbiotech	1mg	EUR 195

STK25 cloning plasmid
CSB-CL022842HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1281 Sequence: atggctcacctccggggatttgccaaccagcactctcgagtggaccctgaggagctcttcaccaagctcgaccgcattggcaagggctcgtttggggaggtctacaagggcatcgataaccacacaaaggaggtggtggccatcaagatcatcgacctggaggaggccgaggatg Show more
Description: A cloning plasmid for the STK25 gene.

STK25 cloning plasmid
CSB-CL022842HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1281 Sequence: atggctcacctccggggatttgccaaccagcactctcgagtggaccctgaggagctcttcaccaagctcgaccgcattggcaagggctcgtttggggaggtctacaagggcatcgataaccacacaaaggaggtggtggccatcaagatcatcgacctggaggaggccgaggatg Show more
Description: A cloning plasmid for the STK25 gene.

anti-STK25 (1G6)
LF-MA10320	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to STK25

Anti-STK25 (4B10)
YF-MA17339	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to STK25

STK25 ELISA KIT|Human
EF003307	Lifescience Market	96 Tests	EUR 689

Mouse STK25 shRNA Plasmid
20-abx975164	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human STK25 shRNA Plasmid
20-abx957131	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

STK25 Recombinant Protein (Rat)
RP231458	ABM	100 ug	Ask for price

pCMV-SPORT6.1-STK25 Plasmid
PVT16016	Lifescience Market	2 ug	EUR 325

STK25 Recombinant Protein (Human)
RP030412	ABM	100 ug	Ask for price

STK25 Recombinant Protein (Human)
RP030415	ABM	100 ug	Ask for price

STK25 Recombinant Protein (Mouse)
RP176060	ABM	100 ug	Ask for price

Serine/Threonine Kinase 25 (STK25) Antibody
20-abx123789	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Serine/Threonine Kinase 25 (STK25) Antibody
abx145678-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Serine/Threonine Kinase 25 (STK25) Antibody
abx034689-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Serine/Threonine Kinase 25 (STK25) Antibody
abx034689-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Serine/Threonine Kinase 25 (STK25) Antibody
abx238328-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Serine/threonine-Protein Kinase 25 (STK25) Antibody
20-abx110200	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase 25 (STK25) Antibody
abx033788-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Serine/Threonine-Protein Kinase 25 (STK25) Antibody
abx033788-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Stk25 ORF Vector (Rat) (pORF)
ORF077154	ABM	1.0 ug DNA	EUR 506

h STK25 inducible lentiviral particles
LVP246	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK25, is fully sequence verified and matched to NCBI accession ID: NM_006374

STK25 ORF Vector (Human) (pORF)
ORF010138	ABM	1.0 ug DNA	EUR 95

STK25 ORF Vector (Human) (pORF)
ORF010139	ABM	1.0 ug DNA	EUR 95

Stk25 ORF Vector (Mouse) (pORF)
ORF058688	ABM	1.0 ug DNA	EUR 506

Stk25 sgRNA CRISPR Lentivector set (Rat)
K7599901	ABM	3 x 1.0 ug	EUR 339

Stk25 sgRNA CRISPR Lentivector set (Mouse)
K3817601	ABM	3 x 1.0 ug	EUR 339

STK25 sgRNA CRISPR Lentivector set (Human)
K2303701	ABM	3 x 1.0 ug	EUR 339

Human Serine/threonine-protein kinase 25 (STK25)
1-CSB-EP022842HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 64.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Serine/threonine-protein kinase 25(STK25) expressed in E.coli

Stk25 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7599902	ABM	1.0 ug DNA	EUR 154

Stk25 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7599903	ABM	1.0 ug DNA	EUR 154

Stk25 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7599904	ABM	1.0 ug DNA	EUR 154

Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3817602	ABM	1.0 ug DNA	EUR 154

Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3817603	ABM	1.0 ug DNA	EUR 154

Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3817604	ABM	1.0 ug DNA	EUR 154

STK25 sgRNA CRISPR Lentivector (Human) (Target 1)
K2303702	ABM	1.0 ug DNA	EUR 154

STK25 sgRNA CRISPR Lentivector (Human) (Target 2)
K2303703	ABM	1.0 ug DNA	EUR 154

STK25 sgRNA CRISPR Lentivector (Human) (Target 3)
K2303704	ABM	1.0 ug DNA	EUR 154

STK25 Protein Vector (Rat) (pPB-C-His)
PV308614	ABM	500 ng	EUR 603

STK25 Protein Vector (Rat) (pPB-N-His)
PV308615	ABM	500 ng	EUR 603

STK25 Protein Vector (Rat) (pPM-C-HA)
PV308616	ABM	500 ng	EUR 603

STK25 Protein Vector (Rat) (pPM-C-His)
PV308617	ABM	500 ng	EUR 603

STK25 Protein Vector (Human) (pPB-C-His)
PV040549	ABM	500 ng	EUR 329

STK25 Protein Vector (Human) (pPB-N-His)
PV040550	ABM	500 ng	EUR 329

STK25 Protein Vector (Human) (pPM-C-HA)
PV040551	ABM	500 ng	EUR 329

STK25 Protein Vector (Human) (pPM-C-His)
PV040552	ABM	500 ng	EUR 329

STK25 Protein Vector (Human) (pPB-C-His)
PV040553	ABM	500 ng	EUR 329

STK25 Protein Vector (Human) (pPB-N-His)
PV040554	ABM	500 ng	EUR 329

STK25 Protein Vector (Human) (pPM-C-HA)
PV040555	ABM	500 ng	EUR 329

STK25 Protein Vector (Human) (pPM-C-His)
PV040556	ABM	500 ng	EUR 329

STK25 Protein Vector (Mouse) (pPB-C-His)
PV234750	ABM	500 ng	EUR 603

STK25 Protein Vector (Mouse) (pPB-N-His)
PV234751	ABM	500 ng	EUR 603

STK25 Rabbit Polyclonal Antibody