STK25 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
STK25 Polyclonal Antibody |
ABP60540-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of STK25 from Human, Mouse. This STK25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250 |
STK25 Polyclonal Antibody |
ABP60540-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of STK25 from Human, Mouse. This STK25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK25 protein at amino acid sequence of 170-250 |
STK25 Polyclonal Antibody |
ES10200-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against STK25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
STK25 Polyclonal Antibody |
ES10200-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against STK25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
STK25 Rabbit pAb |
A9726-100ul |
Abclonal |
100 ul |
EUR 308 |
STK25 Rabbit pAb |
A9726-200ul |
Abclonal |
200 ul |
EUR 459 |
STK25 Rabbit pAb |
A9726-20ul |
Abclonal |
20 ul |
EUR 183 |
STK25 Rabbit pAb |
A9726-50ul |
Abclonal |
50 ul |
EUR 223 |
STK25 Polyclonal Conjugated Antibody |
C31735 |
SAB |
100ul |
EUR 397 |
STK25 antibody |
22448-100ul |
SAB |
100ul |
EUR 390 |
STK25 antibody |
70R-13091 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal STK25 antibody |
STK25 Antibody |
DF9883 |
Affbiotech |
200ul |
EUR 304 |
Description: STK25 Antibody detects endogenous levels of total STK25. |
Stk25 antibody |
70R-8797 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Stk25 antibody |
STK25 Antibody |
1-CSB-PA022842LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Polyclonal STK25 Antibody (C-term) |
APR10930G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK25 (C-term). This antibody is tested and proven to work in the following applications: |
STK25 Polyclonal Antibody, Biotin Conjugated |
A54393 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
STK25 Polyclonal Antibody, FITC Conjugated |
A54394 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
STK25 Polyclonal Antibody, HRP Conjugated |
A54395 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Mouse Stk25 Antibody |
abx028074-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mouse Stk25 Antibody |
abx028074-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
anti- STK25 antibody |
FNab08328 |
FN Test |
100µg |
EUR 585 |
- Immunogen: serine/threonine kinase 25(STE20 homolog, yeast)
- Uniprot ID: O00506
- Gene ID: 10494
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against STK25 |
Anti-STK25 antibody |
STJ111804 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the germinal centre kinase III (GCK III) subfamily of the sterile 20 superfamily of kinases. The encoded enzyme plays a role in serine-threonine liver kinase B1 (LKB1) signaling pathway to regulate neuronal polarization and morphology of the Golgi apparatus. The protein is translocated from the Golgi apparatus to the nucleus in response to chemical anoxia and plays a role in regulation of cell death. A pseudogene associated with this gene is located on chromosome 18. Multiple alternatively spliced transcript variants have been observed for this gene. |
Anti-STK25 antibody |
STJ191358 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to STK25 |
STK25 siRNA |
20-abx935467 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STK25 siRNA |
20-abx935468 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-STK25 |
YF-PA17007 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to STK25 |
anti-STK25 |
YF-PA17008 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to STK25 |
STK25 Antibody, HRP conjugated |
1-CSB-PA022842LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
STK25 Antibody, FITC conjugated |
1-CSB-PA022842LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
STK25 Antibody, Biotin conjugated |
1-CSB-PA022842LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STK25. Recognizes STK25 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Stk25 Blocking Peptide |
33R-9142 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Stk25 antibody, catalog no. 70R-8797 |
STK25 Blocking Peptide |
DF9883-BP |
Affbiotech |
1mg |
EUR 195 |
STK25 cloning plasmid |
CSB-CL022842HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1281
- Sequence: atggctcacctccggggatttgccaaccagcactctcgagtggaccctgaggagctcttcaccaagctcgaccgcattggcaagggctcgtttggggaggtctacaagggcatcgataaccacacaaaggaggtggtggccatcaagatcatcgacctggaggaggccgaggatg
- Show more
|
Description: A cloning plasmid for the STK25 gene. |
STK25 cloning plasmid |
CSB-CL022842HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1281
- Sequence: atggctcacctccggggatttgccaaccagcactctcgagtggaccctgaggagctcttcaccaagctcgaccgcattggcaagggctcgtttggggaggtctacaagggcatcgataaccacacaaaggaggtggtggccatcaagatcatcgacctggaggaggccgaggatg
- Show more
|
Description: A cloning plasmid for the STK25 gene. |
anti-STK25 (1G6) |
LF-MA10320 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to STK25 |
Anti-STK25 (4B10) |
YF-MA17339 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to STK25 |
Mouse STK25 shRNA Plasmid |
20-abx975164 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human STK25 shRNA Plasmid |
20-abx957131 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
STK25 Recombinant Protein (Rat) |
RP231458 |
ABM |
100 ug |
Ask for price |
STK25 Recombinant Protein (Human) |
RP030412 |
ABM |
100 ug |
Ask for price |
STK25 Recombinant Protein (Human) |
RP030415 |
ABM |
100 ug |
Ask for price |
STK25 Recombinant Protein (Mouse) |
RP176060 |
ABM |
100 ug |
Ask for price |
Serine/Threonine Kinase 25 (STK25) Antibody |
20-abx123789 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 25 (STK25) Antibody |
abx145678-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 25 (STK25) Antibody |
abx034689-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 25 (STK25) Antibody |
abx034689-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/Threonine Kinase 25 (STK25) Antibody |
abx238328-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Serine/threonine-Protein Kinase 25 (STK25) Antibody |
20-abx110200 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Serine/Threonine-Protein Kinase 25 (STK25) Antibody |
abx033788-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/Threonine-Protein Kinase 25 (STK25) Antibody |
abx033788-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Stk25 ORF Vector (Rat) (pORF) |
ORF077154 |
ABM |
1.0 ug DNA |
EUR 506 |
h STK25 inducible lentiviral particles |
LVP246 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK25, is fully sequence verified and matched to NCBI accession ID: NM_006374 |
STK25 ORF Vector (Human) (pORF) |
ORF010138 |
ABM |
1.0 ug DNA |
EUR 95 |
STK25 ORF Vector (Human) (pORF) |
ORF010139 |
ABM |
1.0 ug DNA |
EUR 95 |
Stk25 ORF Vector (Mouse) (pORF) |
ORF058688 |
ABM |
1.0 ug DNA |
EUR 506 |
Stk25 sgRNA CRISPR Lentivector set (Rat) |
K7599901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Stk25 sgRNA CRISPR Lentivector set (Mouse) |
K3817601 |
ABM |
3 x 1.0 ug |
EUR 339 |
STK25 sgRNA CRISPR Lentivector set (Human) |
K2303701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Serine/threonine-protein kinase 25 (STK25) |
1-CSB-EP022842HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 64.1 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Serine/threonine-protein kinase 25(STK25) expressed in E.coli |
Stk25 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7599902 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk25 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7599903 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk25 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7599904 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3817602 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3817603 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk25 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3817604 |
ABM |
1.0 ug DNA |
EUR 154 |
STK25 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2303702 |
ABM |
1.0 ug DNA |
EUR 154 |
STK25 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2303703 |
ABM |
1.0 ug DNA |
EUR 154 |
STK25 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2303704 |
ABM |
1.0 ug DNA |
EUR 154 |
STK25 Protein Vector (Rat) (pPB-C-His) |
PV308614 |
ABM |
500 ng |
EUR 603 |
STK25 Protein Vector (Rat) (pPB-N-His) |
PV308615 |
ABM |
500 ng |
EUR 603 |
STK25 Protein Vector (Rat) (pPM-C-HA) |
PV308616 |
ABM |
500 ng |
EUR 603 |
STK25 Protein Vector (Rat) (pPM-C-His) |
PV308617 |
ABM |
500 ng |
EUR 603 |
STK25 Protein Vector (Human) (pPB-C-His) |
PV040549 |
ABM |
500 ng |
EUR 329 |
STK25 Protein Vector (Human) (pPB-N-His) |
PV040550 |
ABM |
500 ng |
EUR 329 |
STK25 Protein Vector (Human) (pPM-C-HA) |
PV040551 |
ABM |
500 ng |
EUR 329 |
STK25 Protein Vector (Human) (pPM-C-His) |
PV040552 |
ABM |
500 ng |
EUR 329 |
STK25 Protein Vector (Human) (pPB-C-His) |
PV040553 |
ABM |
500 ng |
EUR 329 |
STK25 Protein Vector (Human) (pPB-N-His) |
PV040554 |
ABM |
500 ng |
EUR 329 |
STK25 Protein Vector (Human) (pPM-C-HA) |
PV040555 |
ABM |
500 ng |
EUR 329 |
STK25 Protein Vector (Human) (pPM-C-His) |
PV040556 |
ABM |
500 ng |
EUR 329 |
STK25 Protein Vector (Mouse) (pPB-C-His) |
PV234750 |
ABM |
500 ng |
EUR 603 |
STK25 Protein Vector (Mouse) (pPB-N-His) |
PV234751 |
ABM |
500 ng |
EUR 603 |
STK25 Rabbit Polyclonal Antibody