STK40 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

STK40 Polyclonal Antibody
ES10205-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STK40 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
STK40 Polyclonal Antibody
ABP60545-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of STK40 from Human, Mouse, Rat. This STK40 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110
STK40 Polyclonal Antibody
ABP60545-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of STK40 from Human, Mouse, Rat. This STK40 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110
STK40 Polyclonal Antibody
ABP60545-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of STK40 from Human, Mouse, Rat. This STK40 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110
STK40 Antibody
36201-100ul 100ul
EUR 252
STK40 antibody
70R-13420 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal STK40 antibody
STK40 Antibody
1-CSB-PA158011
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STK40. Recognizes STK40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200
STK40 Antibody
1-CSB-PA112765
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STK40. Recognizes STK40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
Polyclonal STK40 Antibody ( C-term )
APR06136G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK40 ( C-term ). This antibody is tested and proven to work in the following applications:
STK40 Conjugated Antibody
C36201 100ul
EUR 397
Anti-STK40 antibody
STJ191363 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to STK40
Stk40/ Rat Stk40 ELISA Kit
ELI-41340r 96 Tests
EUR 886
STK40 siRNA
20-abx905335
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STK40 siRNA
20-abx935491
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STK40 siRNA
20-abx935492
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-STK40
YF-PA21285 50 ug
EUR 363
Description: Mouse polyclonal to STK40
anti-STK40
YF-PA21286 100 ul
EUR 403
Description: Rabbit polyclonal to STK40
anti-STK40
YF-PA26700 50 ul
EUR 334
Description: Mouse polyclonal to STK40
STK40 cloning plasmid
CSB-CL854027HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 702
  • Sequence: atggtgctcaacaagaggacacatcggataaccatcaccaacttctgcctcgggaagcatctggtgagcgagggggacctgctgaaggaccagagagggagccctgcctacatcagtcccgacgtgctcagcggccggccgtaccgtggcaagcccagtgacatgtgggccctggg
  • Show more
Description: A cloning plasmid for the STK40 gene.
STK40 cloning plasmid
CSB-CL854027HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1308
  • Sequence: atgaagcggagagcatcagacagaggagctggggaaacgtcggccagggccaaggctctaggaagtgggatttctggaaataatgcaaagagagctggaccattcatccttggtccccgtctgggcaactcaccggtgccaagcatagtgcagtgtttggcgaggaaagatggca
  • Show more
Description: A cloning plasmid for the STK40 gene.
pDONR223-STK40 Plasmid
PVTB00842 2 ug
EUR 356
Anti-STK40 (4G3)
YF-MA11688 100 ug
EUR 363
Description: Mouse monoclonal to STK40
Serine/threonine Kinase 40 (STK40) Antibody
abx145680-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Serine/threonine Kinase 40 (STK40) Antibody
abx034199-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Serine/threonine Kinase 40 (STK40) Antibody
abx034199-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Serine/threonine Kinase 40 (STK40) Antibody
20-abx214209
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Serine/threonine Kinase 40 (STK40) Antibody
20-abx214607
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mouse STK40 shRNA Plasmid
20-abx978130
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat STK40 shRNA Plasmid
20-abx990029
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human STK40 shRNA Plasmid
20-abx963240
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
STK40 Recombinant Protein (Human)
RP030442 100 ug Ask for price
STK40 Recombinant Protein (Human)
RP030445 100 ug Ask for price
STK40 Recombinant Protein (Rat)
RP231494 100 ug Ask for price
STK40 Recombinant Protein (Mouse)
RP176108 100 ug Ask for price
STK40 Recombinant Protein (Mouse)
RP176111 100 ug Ask for price
Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit
E04S0412-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit
E04S0412-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit
E04S0412-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monoclonal STK40 Antibody (monoclonal) (M04), Clone: 4G3
AMM04153G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human STK40 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4G3. This antibody is applicable in WB and IHC
h STK40 inducible lentiviral particles
LVP202 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK40, is fully sequence verified and matched to NCBI accession ID: NM_032017
Stk40 ORF Vector (Mouse) (pORF)
ORF058704 1.0 ug DNA
EUR 506
Stk40 ORF Vector (Mouse) (pORF)
ORF058705 1.0 ug DNA
EUR 506
STK40 ORF Vector (Human) (pORF)
ORF010148 1.0 ug DNA
EUR 95
STK40 ORF Vector (Human) (pORF)
ORF010149 1.0 ug DNA
EUR 95
Stk40 ORF Vector (Rat) (pORF)
ORF077166 1.0 ug DNA
EUR 506
STK40 sgRNA CRISPR Lentivector set (Human)
K2304901 3 x 1.0 ug
EUR 339
Stk40 sgRNA CRISPR Lentivector set (Mouse)
K4693801 3 x 1.0 ug
EUR 339
Stk40 sgRNA CRISPR Lentivector set (Rat)
K6422301 3 x 1.0 ug
EUR 339
STK40 sgRNA CRISPR Lentivector (Human) (Target 1)
K2304902 1.0 ug DNA
EUR 154
STK40 sgRNA CRISPR Lentivector (Human) (Target 2)
K2304903 1.0 ug DNA
EUR 154
STK40 sgRNA CRISPR Lentivector (Human) (Target 3)
K2304904 1.0 ug DNA
EUR 154
Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4693802 1.0 ug DNA
EUR 154
Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4693803 1.0 ug DNA
EUR 154
Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4693804 1.0 ug DNA
EUR 154
Stk40 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6422302 1.0 ug DNA
EUR 154
Stk40 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6422303 1.0 ug DNA
EUR 154
Stk40 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6422304 1.0 ug DNA
EUR 154
STK40 Protein Vector (Human) (pPB-C-His)
PV040589 500 ng
EUR 329
STK40 Protein Vector (Human) (pPB-N-His)
PV040590 500 ng
EUR 329
STK40 Protein Vector (Human) (pPM-C-HA)
PV040591 500 ng
EUR 329
STK40 Protein Vector (Human) (pPM-C-His)
PV040592 500 ng
EUR 329
STK40 Protein Vector (Human) (pPB-C-His)
PV040593 500 ng
EUR 329
STK40 Protein Vector (Human) (pPB-N-His)
PV040594 500 ng
EUR 329
STK40 Protein Vector (Human) (pPM-C-HA)
PV040595 500 ng
EUR 329
STK40 Protein Vector (Human) (pPM-C-His)
PV040596 500 ng
EUR 329
STK40 Protein Vector (Rat) (pPB-C-His)
PV308662 500 ng
EUR 603
STK40 Protein Vector (Rat) (pPB-N-His)
PV308663 500 ng
EUR 603
STK40 Protein Vector (Rat) (pPM-C-HA)
PV308664 500 ng
EUR 603
STK40 Protein Vector (Rat) (pPM-C-His)
PV308665 500 ng
EUR 603
STK40 Protein Vector (Mouse) (pPB-C-His)
PV234814 500 ng
EUR 603
STK40 Protein Vector (Mouse) (pPB-N-His)
PV234815 500 ng
EUR 603
STK40 Protein Vector (Mouse) (pPM-C-HA)
PV234816 500 ng
EUR 603
STK40 Protein Vector (Mouse) (pPM-C-His)
PV234817 500 ng
EUR 603
STK40 Protein Vector (Mouse) (pPB-C-His)
PV234818 500 ng
EUR 603
STK40 Protein Vector (Mouse) (pPB-N-His)
PV234819 500 ng
EUR 603
STK40 Protein Vector (Mouse) (pPM-C-HA)
PV234820 500 ng
EUR 603
STK40 Protein Vector (Mouse) (pPM-C-His)
PV234821 500 ng
EUR 603
Stk40 3'UTR GFP Stable Cell Line
TU169860 1.0 ml Ask for price
Stk40 3'UTR Luciferase Stable Cell Line
TU119860 1.0 ml Ask for price
STK40 3'UTR GFP Stable Cell Line
TU074832 1.0 ml
EUR 2333
STK40 3'UTR Luciferase Stable Cell Line
TU024832 1.0 ml
EUR 2333
Stk40 3'UTR Luciferase Stable Cell Line
TU221326 1.0 ml Ask for price
Stk40 3'UTR GFP Stable Cell Line
TU271326 1.0 ml Ask for price
STK40 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV665677 1.0 ug DNA
EUR 682
STK40 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV665681 1.0 ug DNA
EUR 682
STK40 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV665682 1.0 ug DNA
EUR 682
STK40 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715521 1.0 ug DNA
EUR 316
STK40 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV715525 1.0 ug DNA
EUR 316
STK40 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV715526 1.0 ug DNA
EUR 316
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

STK40 Rabbit Polyclonal Antibody