SYF2 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

SYF2 Polyclonal Antibody
ES10047-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SYF2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
SYF2 Polyclonal Antibody
ABP60563-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SYF2 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of SYF2 from Human, Mouse, Rat. This SYF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYF2 protein at amino acid sequence of 160-240
SYF2 Polyclonal Antibody
ABP60563-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SYF2 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of SYF2 from Human, Mouse, Rat. This SYF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYF2 protein at amino acid sequence of 160-240
SYF2 Polyclonal Antibody
ABP60563-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SYF2 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of SYF2 from Human, Mouse, Rat. This SYF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SYF2 protein at amino acid sequence of 160-240
SYF2 Polyclonal Antibody
A61218 100 µg
EUR 570.55
Description: reagents widely cited
SYF2 Rabbit pAb
A14396-100ul 100 ul
EUR 308
SYF2 Rabbit pAb
A14396-200ul 200 ul
EUR 459
SYF2 Rabbit pAb
A14396-20ul 20 ul
EUR 183
SYF2 Rabbit pAb
A14396-50ul 50 ul
EUR 223
SYF2 antibody
70R-20662 50 ul
EUR 435
Description: Rabbit polyclonal SYF2 antibody
SYF2 Antibody
ABD2224 100 ug
EUR 438
SYF2 Antibody
44679-100ul 100ul
EUR 252
SYF2 Antibody
44679-50ul 50ul
EUR 187
SYF2 Antibody
DF2224 200ul
EUR 304
Description: SYF2 antibody detects endogenous levels of total SYF2.
SYF2 Antibody
1-CSB-PA022996GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SYF2. Recognizes SYF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
SYF2 Antibody
1-CSB-PA022996LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYF2. Recognizes SYF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
SYF2 Polyclonal Antibody, Biotin Conjugated
A61219 100 µg
EUR 570.55
Description: Ask the seller for details
SYF2 Polyclonal Antibody, FITC Conjugated
A61220 100 µg
EUR 570.55
Description: The best epigenetics products
SYF2 Polyclonal Antibody, HRP Conjugated
A61221 100 µg
EUR 570.55
Description: kits suitable for this type of research
SYF2 Pre-mRNA Splicing Factor (SYF2) Antibody
20-abx148967
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
SYF2 Pre-mRNA Splicing Factor (SYF2) Antibody
abx238412-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SYF2 Pre-mRNA Splicing Factor (SYF2) Antibody
20-abx305479
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Syf2/ Rat Syf2 ELISA Kit
ELI-30017r 96 Tests
EUR 886
SYF2 Conjugated Antibody
C44679 100ul
EUR 397
anti- SYF2 antibody
FNab08412 100µg
EUR 548.75
  • Immunogen: SYF2 homolog, RNA splicing factor(S. cerevisiae)
  • Uniprot ID: O95926
  • Gene ID: 25949
  • Research Area: Neuroscience
Description: Antibody raised against SYF2
Anti-SYF2 antibody
PAab08412 100 ug
EUR 386
Anti-SYF2 antibody
STJ116608 100 µl
EUR 277
Description: This gene encodes a nuclear protein that interacts with cyclin D-type binding-protein 1, which is thought to be a cell cycle regulator at the G1/S transition. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-SYF2 antibody
STJ191205 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SYF2
SYF2 Pre-mRNA Splicing Factor (SYF2) Antibody (HRP)
20-abx305480
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SYF2 Pre-mRNA Splicing Factor (SYF2) Antibody (FITC)
20-abx305481
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SYF2 Pre-mRNA Splicing Factor (SYF2) Antibody (Biotin)
20-abx305482
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SYF2 siRNA
20-abx905394
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SYF2 siRNA
20-abx935775
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SYF2 siRNA
20-abx935776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Syf2 Homolog, Rna Splicing Factor (S. Cerevisiae) (SYF2) Antibody
20-abx115935
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
SYF2 Antibody, HRP conjugated
1-CSB-PA022996LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYF2. Recognizes SYF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SYF2 Antibody, FITC conjugated
1-CSB-PA022996LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYF2. Recognizes SYF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SYF2 Antibody, Biotin conjugated
1-CSB-PA022996LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SYF2. Recognizes SYF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SYF2 Pre-mRNA Splicing Factor (SYF2) Protein
20-abx263219
  • EUR 230.00
  • EUR 1483.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.
SYF2 cloning plasmid
CSB-CL022996HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 732
  • Sequence: atggcggctatagctgcatccgaggtgctggtggacagcgcggaggaggggtccctcgctgcggcggcggagctggccgctcagaagcgcgaacagagactgcgcaaattccgggagctgcacctgatgcggaatgaagctcgtaaattaaatcaccaggaagttgtggaagaaga
  • Show more
Description: A cloning plasmid for the SYF2 gene.
SYF2 Blocking Peptide
DF2224-BP 1mg
EUR 195
pCMV-SPORT6-SYF2
PVT12858 2 ug
EUR 391
Mouse Pre- mRNA- splicing factor SYF2, Syf2 ELISA KIT
ELI-46228m 96 Tests
EUR 865
Human Pre- mRNA- splicing factor SYF2, SYF2 ELISA KIT
ELI-41640h 96 Tests
EUR 824
Human SYF2 Pre-mRNA Splicing Factor (SYF2) ELISA Kit
abx383584-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse SYF2 shRNA Plasmid
20-abx976672
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat SYF2 shRNA Plasmid
20-abx987641
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SYF2 ELISA KIT|Human
EF003380 96 Tests
EUR 689
Human SYF2 shRNA Plasmid
20-abx958611
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SYF2 protein (His tag)
80R-2022 10 ug
EUR 322
Description: Recombinant human SYF2 protein (His tag)
SYF2 Recombinant Protein (Human)
RP030718 100 ug Ask for price
SYF2 Recombinant Protein (Rat)
RP231866 100 ug Ask for price
SYF2 Recombinant Protein (Mouse)
RP176702 100 ug Ask for price
Syf2 ORF Vector (Mouse) (pORF)
ORF058902 1.0 ug DNA
EUR 506
SYF2 ORF Vector (Human) (pORF)
ORF010240 1.0 ug DNA
EUR 95
Syf2 ORF Vector (Rat) (pORF)
ORF077290 1.0 ug DNA
EUR 506
SYF2 sgRNA CRISPR Lentivector set (Human)
K2319501 3 x 1.0 ug
EUR 339
Syf2 sgRNA CRISPR Lentivector set (Mouse)
K3506101 3 x 1.0 ug
EUR 339
Syf2 sgRNA CRISPR Lentivector set (Rat)
K6961001 3 x 1.0 ug
EUR 339
SYF2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2319502 1.0 ug DNA
EUR 154
SYF2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2319503 1.0 ug DNA
EUR 154
SYF2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2319504 1.0 ug DNA
EUR 154
Syf2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3506102 1.0 ug DNA
EUR 154
Syf2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3506103 1.0 ug DNA
EUR 154
Syf2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3506104 1.0 ug DNA
EUR 154
Syf2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6961002 1.0 ug DNA
EUR 154
Syf2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6961003 1.0 ug DNA
EUR 154
Syf2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6961004 1.0 ug DNA
EUR 154
SYF2 RNA splicing factor Human Recombinant Protein
PROTO95926 Regular: 5ug
EUR 317
Description: SYF2 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 173 amino acids (94-243) and having a molecular mass of 20.5kDa.;SYF2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
SYF2 Protein Vector (Human) (pPB-C-His)
PV040957 500 ng
EUR 329
SYF2 Protein Vector (Human) (pPB-N-His)
PV040958 500 ng
EUR 329
SYF2 Protein Vector (Human) (pPM-C-HA)
PV040959 500 ng
EUR 329
SYF2 Protein Vector (Human) (pPM-C-His)
PV040960 500 ng
EUR 329
Recombinant Human SYF2 Protein, His, E.coli-1ug
QP13655-1ug 1ug
EUR 155
Recombinant Human SYF2 Protein, His, E.coli-50ug
QP13655-50ug 50ug
EUR 1161
Recombinant Human SYF2 Protein, His, E.coli-5ug
QP13655-5ug 5ug
EUR 201
SYF2 Protein Vector (Rat) (pPB-C-His)
PV309158 500 ng
EUR 603
SYF2 Protein Vector (Rat) (pPB-N-His)
PV309159 500 ng
EUR 603
SYF2 Protein Vector (Rat) (pPM-C-HA)
PV309160 500 ng
EUR 603
SYF2 Protein Vector (Rat) (pPM-C-His)
PV309161 500 ng
EUR 603
SYF2 Protein Vector (Mouse) (pPB-C-His)
PV235606 500 ng
EUR 603
SYF2 Protein Vector (Mouse) (pPB-N-His)
PV235607 500 ng
EUR 603
SYF2 Protein Vector (Mouse) (pPM-C-HA)
PV235608 500 ng
EUR 603
SYF2 Protein Vector (Mouse) (pPM-C-His)
PV235609 500 ng
EUR 603
Syf2 3'UTR GFP Stable Cell Line
TU170007 1.0 ml Ask for price
Syf2 3'UTR Luciferase Stable Cell Line
TU120007 1.0 ml Ask for price
SYF2 3'UTR GFP Stable Cell Line
TU074988 1.0 ml
EUR 1394
SYF2 3'UTR Luciferase Stable Cell Line
TU024988 1.0 ml
EUR 1394
Syf2 3'UTR Luciferase Stable Cell Line
TU221454 1.0 ml Ask for price
Syf2 3'UTR GFP Stable Cell Line
TU271454 1.0 ml Ask for price
SYF2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV792997 1.0 ug DNA
EUR 316
SYF2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV792998 1.0 ug DNA
EUR 316
SYF2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV625711 1.0 ug DNA
EUR 514
SYF2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV625715 1.0 ug DNA
EUR 514
SYF2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV625716 1.0 ug DNA
EUR 514
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

SYF2 Rabbit Polyclonal Antibody