TAF7 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

TAF7 Polyclonal Antibody
ES10382-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TAF7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TAF7 Polyclonal Antibody
ABP60612-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TAF7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TAF7 from Human, Mouse. This TAF7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF7 protein
TAF7 Polyclonal Antibody
ABP60612-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TAF7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TAF7 from Human, Mouse. This TAF7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF7 protein
TAF7 Polyclonal Antibody
ABP60612-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TAF7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TAF7 from Human, Mouse. This TAF7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TAF7 protein
TAF7 Rabbit pAb
A8906-100ul 100 ul
EUR 308
TAF7 Rabbit pAb
A8906-200ul 200 ul
EUR 459
TAF7 Rabbit pAb
A8906-20ul 20 ul Ask for price
TAF7 Rabbit pAb
A8906-50ul 50 ul Ask for price
TAF7 antibody
70R-20695 50 ul
EUR 435
Description: Rabbit polyclonal TAF7 antibody
TAF7 Antibody
ABD2253 100 ug
EUR 438
TAF7 Antibody
44694-100ul 100ul
EUR 252
TAF7 Antibody
44694-50ul 50ul
EUR 187
TAF7 Antibody
DF2253 200ul
EUR 304
Description: TAF7 antibody detects endogenous levels of total TAF7.
TAF7 Antibody
1-CSB-PA023097GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TAF7. Recognizes TAF7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
TAF7 Conjugated Antibody
C44694 100ul
EUR 397
anti- TAF7 antibody
FNab08488 100µg
EUR 548.75
  • Immunogen: TAF7 RNA polymerase II, TATA box binding protein(TBP)-associated factor, 55kDa
  • Uniprot ID: Q15545
  • Gene ID: 6879
  • Research Area: Metabolism
Description: Antibody raised against TAF7
Anti-TAF7 antibody
PAab08488 100 ug
EUR 386
Anti-TAF7 antibody
STJ111471 100 µl
EUR 277
Description: The intronless gene for this transcription coactivator is located between the protocadherin beta and gamma gene clusters on chromosome 5. The protein encoded by this gene is a component of the TFIID protein complex, a complex which binds to the TATA box in class II promoters and recruits RNA polymerase II and other factors. This particular subunit interacts with the largest TFIID subunit, as well as multiple transcription activators. The protein is required for transcription by promoters targeted by RNA polymerase II.
Anti-TAF7 antibody
STJ191540 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TAF7
TAF7 siRNA
20-abx935987
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TAF7 siRNA
20-abx935988
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TAF7
YF-PA14896 50 ul
EUR 363
Description: Mouse polyclonal to TAF7
anti-TAF7
YF-PA14897 100 ug
EUR 403
Description: Rabbit polyclonal to TAF7
TAF7 Blocking Peptide
DF2253-BP 1mg
EUR 195
TAF7 cloning plasmid
CSB-CL623003HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1050
  • Sequence: atgagtaaaagcaaagatgatgctcctcacgaactggagagccagtttatcttacgtctgcctccagaatatgcctctactgtgagaagggcagtacagtctggtcatgtcaacctcaaggacagactgacaattgagttacatcctgatgggcgtcatggaatcgtcagagtgg
  • Show more
Description: A cloning plasmid for the TAF7 gene.
Anti-TAF7 (3G6)
YF-MA15712 100 ug
EUR 363
Description: Mouse monoclonal to TAF7
Anti-TAF7 (2C5)
YF-MA10904 100 ug
EUR 363
Description: Mouse monoclonal to TAF7
Mouse TAF7 shRNA Plasmid
20-abx973631
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Bovine TAF7 ELISA KIT
ELI-13729b 96 Tests
EUR 928
Human TAF7 ELISA KIT
ELI-17300h 96 Tests
EUR 824
TAF7 ELISA KIT|Human
EF003442 96 Tests
EUR 689
Mouse Taf7 ELISA KIT
ELI-41689m 96 Tests
EUR 865
Human TAF7 shRNA Plasmid
20-abx954708
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TAF7 Recombinant Protein (Human)
RP030865 100 ug Ask for price

TAF7 Rabbit Polyclonal Antibody