TMC7 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

TMC7 Antibody

46286-100ul 100ul
EUR 252

TMC7 Antibody

46286-50ul 50ul
EUR 187

TMC7 Antibody

DF9975 200ul
EUR 304
Description: TMC7 Antibody detects endogenous levels of total TMC7.

TMC7 antibody

70R-51400 100 ul
EUR 244
Description: Purified Polyclonal TMC7 antibody

TMC7 Antibody

ABD9975 100 ug
EUR 438

TMC7 Conjugated Antibody

C46286 100ul
EUR 397

Anti-TMC7 antibody

STJ191553 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TMC7

TMC7 siRNA

20-abx936966
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMC7 siRNA

20-abx936967
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TMC7 Blocking Peptide

DF9975-BP 1mg
EUR 195

TMC7 Blocking Peptide

20-abx064275
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

TMC7 cloning plasmid

CSB-CL773587HU-10ug 10ug
EUR 717
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2172
  • Sequence: atgagcgagtccagcggcagtgcgctccagcccggcaggcccagccggcagccggcggtccatccagagaacctctctctagactccagttgcttctcttctccacctgtgaacttcctccaagaattgccaagctaccggtccattgcacgtaggagaacgactgtccattcct
  • Show more
Description: A cloning plasmid for the TMC7 gene.

pCMV-SPORT6-TMC7

PVT19121 2 ug
EUR 231

Mouse TMC7 shRNA Plasmid

20-abx980636
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TMC7 shRNA Plasmid

20-abx962656
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TMC7 Recombinant Protein (Rat)

RP233363 100 ug Ask for price

TMC7 Recombinant Protein (Human)

RP031774 100 ug Ask for price

TMC7 Recombinant Protein (Mouse)

RP179087 100 ug Ask for price

Rabbit Transmembrane channel like protein 7(TMC7) ELISA kit

E04T0698-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transmembrane channel like protein 7(TMC7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transmembrane channel like protein 7(TMC7) ELISA kit

E04T0698-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transmembrane channel like protein 7(TMC7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transmembrane channel like protein 7(TMC7) ELISA kit

E04T0698-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transmembrane channel like protein 7(TMC7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Transmembrane Channel-Like Protein 7 (TMC7) Antibody

20-abx007758
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Transmembrane Channel-Like Protein 7 (TMC7) Antibody

20-abx219115
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tmc7 ORF Vector (Rat) (pORF)

ORF077789 1.0 ug DNA
EUR 506

TMC7 ORF Vector (Human) (pORF)

ORF010592 1.0 ug DNA
EUR 95

Tmc7 ORF Vector (Mouse) (pORF)

ORF059697 1.0 ug DNA
EUR 506

Tmc7 sgRNA CRISPR Lentivector set (Rat)

K6183901 3 x 1.0 ug
EUR 339

Tmc7 sgRNA CRISPR Lentivector set (Mouse)

K4501501 3 x 1.0 ug
EUR 339

TMC7 sgRNA CRISPR Lentivector set (Human)

K2383601 3 x 1.0 ug
EUR 339

Tmc7 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6183902 1.0 ug DNA
EUR 154

Tmc7 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6183903 1.0 ug DNA
EUR 154

Tmc7 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6183904 1.0 ug DNA
EUR 154

Tmc7 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4501502 1.0 ug DNA
EUR 154

Tmc7 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4501503 1.0 ug DNA
EUR 154

Tmc7 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4501504 1.0 ug DNA
EUR 154

TMC7 sgRNA CRISPR Lentivector (Human) (Target 1)

K2383602 1.0 ug DNA
EUR 154

TMC7 sgRNA CRISPR Lentivector (Human) (Target 2)

K2383603 1.0 ug DNA
EUR 154

TMC7 sgRNA CRISPR Lentivector (Human) (Target 3)

K2383604 1.0 ug DNA
EUR 154

TMC7 Protein Vector (Rat) (pPB-C-His)

PV311154 500 ng
EUR 1166

TMC7 Protein Vector (Rat) (pPB-N-His)

PV311155 500 ng
EUR 1166

TMC7 Protein Vector (Rat) (pPM-C-HA)

PV311156 500 ng
EUR 1166

TMC7 Protein Vector (Rat) (pPM-C-His)

PV311157 500 ng
EUR 1166

TMC7 Protein Vector (Mouse) (pPB-C-His)

PV238786 500 ng
EUR 1065

TMC7 Protein Vector (Mouse) (pPB-N-His)

PV238787 500 ng
EUR 1065

TMC7 Protein Vector (Mouse) (pPM-C-HA)

PV238788 500 ng
EUR 1065

TMC7 Protein Vector (Mouse) (pPM-C-His)

PV238789 500 ng
EUR 1065

TMC7 Protein Vector (Human) (pPB-C-His)

PV042365 500 ng
EUR 329

TMC7 Rabbit Polyclonal Antibody