TNNC2 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

TNNC2 Polyclonal Antibody
ABP60720-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TNNC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TNNC2 from Human, Mouse. This TNNC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TNNC2 protein
TNNC2 Polyclonal Antibody
ABP60720-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TNNC2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TNNC2 from Human, Mouse. This TNNC2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TNNC2 protein
TNNC2 Polyclonal Antibody
ES10398-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TNNC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TNNC2 Polyclonal Antibody
ES10398-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TNNC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TNNC2 Rabbit pAb
A7740-100ul 100 ul
EUR 308
TNNC2 Rabbit pAb
A7740-200ul 200 ul
EUR 459
TNNC2 Rabbit pAb
A7740-20ul 20 ul
EUR 183
TNNC2 Rabbit pAb
A7740-50ul 50 ul
EUR 223
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit
DLR-TNNC2-Hu-48T 48T
EUR 517
  • Should the Human Troponin C Type 2, Fast (TNNC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin C Type 2, Fast (TNNC2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit
DLR-TNNC2-Hu-96T 96T
EUR 673
  • Should the Human Troponin C Type 2, Fast (TNNC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Troponin C Type 2, Fast (TNNC2) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit
RDR-TNNC2-Hu-48Tests 48 Tests
EUR 544
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit
RDR-TNNC2-Hu-96Tests 96 Tests
EUR 756
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit
RD-TNNC2-Hu-48Tests 48 Tests
EUR 521
Human Troponin C Type 2, Fast (TNNC2) ELISA Kit
RD-TNNC2-Hu-96Tests 96 Tests
EUR 723
TNNC2 Antibody
47442-100ul 100ul
EUR 252
TNNC2 Antibody
1-CSB-PA024010ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TNNC2. Recognizes TNNC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000
TNNC2 Antibody
1-CSB-PA024010ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TNNC2. Recognizes TNNC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
Rabbit TNNC2 ELISA Kit
ERTT0256 96Tests
EUR 521
Polyclonal TNNC2 Antibody(C-term)
AMM08263G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNNC2 (C-term). This antibody is tested and proven to work in the following applications:
TNNC2 Conjugated Antibody
C47442 100ul
EUR 397
anti- TNNC2 antibody
FNab08836 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: troponin C type 2 (fast)
  • Uniprot ID: P02585
  • Gene ID: 7125
  • Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against TNNC2
Anti-TNNC2 antibody
PAab08836 100 ug
EUR 386
Anti-TNNC2 antibody
STJ110051 100 µl
EUR 277
Description: Troponin (Tn), a key protein complex in the regulation of striated muscle contraction, is composed of 3 subunits. The Tn-I subunit inhibits actomyosin ATPase, the Tn-T subunit binds tropomyosin and Tn-C, while the Tn-C subunit binds calcium and overcomes the inhibitory action of the troponin complex on actin filaments. The protein encoded by this gene is the Tn-C subunit.
Anti-TNNC2 antibody
STJ191556 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TNNC2
TNNC2 siRNA
20-abx937666
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TNNC2 siRNA
20-abx937667
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TNNC2
YF-PA24866 50 ul
EUR 334
Description: Mouse polyclonal to TNNC2
TNNC2 cloning plasmid
CSB-CL024010HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 483
  • Sequence: atgacggaccagcaggctgaggccaggtcctacctcagcgaagagatgatcgctgagttcaaggctgcctttgacatgtttgatgctgatggtggtggggacatcagcgtcaaggagttgggcacggtgatgaggatgctgggccagacacccaccaaggaggagctggacgccat
  • Show more
Description: A cloning plasmid for the TNNC2 gene.
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human)
4-PAD228Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2)
Troponin C Type 2, Fast (TNNC2) Polyclonal Antibody (Human)
4-PAD228Hu02
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TNNC2 (Thr2~Gln160)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Troponin C Type 2, Fast (TNNC2)
Rabbit Troponin C, Skeletal Muscle (TNNC2) ELISA Kit
abx362622-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rabbit Troponin C, skeletal muscle, TNNC2 ELISA KIT
ELI-39995Ra 96 Tests
EUR 928
Troponin C Type 2 (TNNC2) Antibody
20-abx006037
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Troponin C Type 2 (TNNC2) Antibody
20-abx142271
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Troponin C Type 2 (TNNC2) Antibody
abx031096-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Troponin C Type 2 (TNNC2) Antibody
abx031096-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Troponin C Type 2 (TNNC2) Antibody
abx238836-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Troponin C Type 2 (TNNC2) Antibody
20-abx322212
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Troponin C Type 2 (TNNC2) Antibody
20-abx322296
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human TNNC2 ELISA Kit
EHT0256 96Tests
EUR 521
Bovine TNNC2 ELISA Kit
EBT0256 96Tests
EUR 521
Anserini TNNC2 ELISA Kit
EAT0256 96Tests
EUR 521
Chicken TNNC2 ELISA Kit
ECKT0256 96Tests
EUR 521
Canine TNNC2 ELISA Kit
ECT0256 96Tests
EUR 521
Goat TNNC2 ELISA Kit
EGTT0256 96Tests
EUR 521
TNNC2 ELISA KIT|Human
EF007216 96 Tests
EUR 689
Mouse TNNC2 shRNA Plasmid
20-abx973148
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TNNC2 shRNA Plasmid
20-abx954886
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Sheep TNNC2 ELISA Kit
EST0256 96Tests
EUR 521
Porcine TNNC2 ELISA Kit
EPT0256 96Tests
EUR 521

TNNC2 Rabbit Polyclonal Antibody