TRPC1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

TRPC1 Polyclonal Antibody

ABP60767-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TRPC1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPC1 from Human, Mouse, Rat. This TRPC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC1 protein

TRPC1 Polyclonal Antibody

ABP60767-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TRPC1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPC1 from Human, Mouse, Rat. This TRPC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC1 protein

TRPC1 Polyclonal Antibody

ABP60767-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TRPC1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPC1 from Human, Mouse, Rat. This TRPC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC1 protein

TRPC1 Polyclonal Antibody

31784-100ul 100ul
EUR 252

TRPC1 Polyclonal Antibody

31784-50ul 50ul
EUR 187

TRPC1 Polyclonal Antibody

27711-100ul 100ul
EUR 252

TRPC1 Polyclonal Antibody

27711-50ul 50ul
EUR 187

TRPC1 Polyclonal Antibody

28426-100ul 100ul
EUR 252

TRPC1 Polyclonal Antibody

28426-50ul 50ul
EUR 187

TRPC1 Rabbit pAb

A12525-100ul 100 ul
EUR 308

TRPC1 Rabbit pAb

A12525-200ul 200 ul
EUR 459

TRPC1 Rabbit pAb

A12525-20ul 20 ul
EUR 183

TRPC1 Rabbit pAb

A12525-50ul 50 ul
EUR 223

TRPC1 Rabbit mAb

A4016-100ul 100 ul
EUR 410

TRPC1 Rabbit mAb

A4016-200ul 200 ul
EUR 571

TRPC1 Rabbit mAb

A4016-20ul 20 ul
EUR 221

TRPC1 Rabbit mAb

A4016-50ul 50 ul
EUR 287

TRPC1 Rabbit pAb

A14068-100ul 100 ul
EUR 308

TRPC1 Rabbit pAb

A14068-200ul 200 ul
EUR 459

TRPC1 Rabbit pAb

A14068-20ul 20 ul
EUR 183

TRPC1 Rabbit pAb

A14068-50ul 50 ul
EUR 223

TRPC1 Rabbit pAb

A9952-100ul 100 ul
EUR 308

TRPC1 Rabbit pAb

A9952-200ul 200 ul
EUR 459

TRPC1 Rabbit pAb

A9952-20ul 20 ul
EUR 183

TRPC1 Rabbit pAb

A9952-50ul 50 ul
EUR 223

Polyclonal TRPC1 Antibody (Internal)

APG01095G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRPC1 (Internal). This antibody is tested and proven to work in the following applications:

TRPC1 Polyclonal Conjugated Antibody

C31784 100ul
EUR 397

TRPC1 Polyclonal Conjugated Antibody

C27711 100ul
EUR 397

TRPC1 Polyclonal Conjugated Antibody

C28426 100ul
EUR 397

TRPC1 antibody

70R-21010 50 ul
EUR 435
Description: Rabbit polyclonal TRPC1 antibody

TRPC1 Antibody

DF12783 200ul
EUR 304
Description: TRPC1 Antibody detects endogenous levels of TRPC1.

TRPC1 Antibody

1-CSB-PA025075GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TRPC1. Recognizes TRPC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TRPC1 Antibody

1-CSB-PA025075LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPC1. Recognizes TRPC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal TRPC1 Antibody (C-term)

APR04147G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPC1 (C-term). This antibody is tested and proven to work in the following applications:

anti- TRPC1 antibody

FNab09014 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:200
  • Immunogen: transient receptor potential cation channel, subfamily C, member 1
  • Uniprot ID: P48995
  • Gene ID: 7220
  • Research Area: Neuroscience, Cardiovascular, Signal Transduction
Description: Antibody raised against TRPC1

Anti-TRPC1 antibody

PAab09014 100 ug
EUR 386

Anti-TRPC1 antibody

STJ73487 100 µg
EUR 359

Anti-TRPC1 antibody

STJ111993 100 µl
EUR 277
Description: The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene.

Anti-TRPC1 antibody

STJ114399 100 µl
EUR 277
Description: The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene.

Anti-TRPC1 antibody

STJ191415 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRPC1

Anti-TRPC1 antibody

STJ116003 100 µl
EUR 277
Description: The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene.

Trpc1/ Rat Trpc1 ELISA Kit

ELI-16583r 96 Tests
EUR 886

TRPC1 siRNA

20-abx905810
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRPC1 siRNA

20-abx938207
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TRPC1 siRNA

20-abx938208
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TRPC1

YF-PA24899 50 ul
EUR 334
Description: Mouse polyclonal to TRPC1

TRPC1 Antibody, HRP conjugated

1-CSB-PA025075LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPC1. Recognizes TRPC1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TRPC1 Antibody, FITC conjugated

1-CSB-PA025075LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPC1. Recognizes TRPC1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TRPC1 Antibody, Biotin conjugated

1-CSB-PA025075LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TRPC1. Recognizes TRPC1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TRPC1 cloning plasmid

CSB-CL025075HU-10ug 10ug
EUR 748
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2280
  • Sequence: ATGATGGCGGCCCTGTACCCGAGCACGGACCTCTCGGGCGCCTCCTCCTCCTCCCTGCCTTCCTCTCCATCCTCTTCCTCGCCGAACGAGGTGATGGCGCTGAAGGATGTGCGGGAGGTGAAGGAGGAGAATACGCTGAATGAGAAGCTTTTCTTGCTGGCGTGCGACAAGGGTG
  • Show more
Description: A cloning plasmid for the TRPC1 gene.

TRPC1 Blocking Peptide

DF12783-BP 1mg
EUR 195

Anti-TRPC1 (1E4)

YF-MA20445 50 ug
EUR 363
Description: Mouse monoclonal to TRPC1

Anti-TRPC1 (1E4)

YF-MA20446 200 ul
EUR 363
Description: Mouse monoclonal to TRPC1

Rat TRPC1 shRNA Plasmid

20-abx987058
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human TRPC1 ELISA kit

ELA-E12154h 96 Tests
EUR 824

Mouse Trpc1 ELISA KIT

ELI-23164m 96 Tests
EUR 865

TRPC1 ELISA KIT|Human

EF007445 96 Tests
EUR 689

Bovine TRPC1 ELISA KIT

ELI-51848b 96 Tests
EUR 928

Human TRPC1 ELISA KIT

ELI-51849h 96 Tests
EUR 824

Human TRPC1 shRNA Plasmid

20-abx954945
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse TRPC1 shRNA Plasmid

20-abx973225
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TRPC1 Recombinant Protein (Human)

RP044494 100 ug Ask for price

TRPC1 Recombinant Protein (Rat)

RP234839 100 ug Ask for price

TRPC1 Recombinant Protein (Mouse)

RP181496 100 ug Ask for price

pCR-BluntII-TOPO-TRPC1

PVT14574 2 ug
EUR 495

Rabbit Short transient receptor potential channel 1, TRPC1 ELISA

ELI-51850Ra 96 Tests
EUR 928

Trpc1 ORF Vector (Rat) (pORF)

ORF078281 1.0 ug DNA
EUR 506

TRPC1 ORF Vector (Human) (pORF)

ORF014832 1.0 ug DNA
EUR 354

Trpc1 ORF Vector (Mouse) (pORF)

ORF060500 1.0 ug DNA
EUR 506

TRPC1 ELISA Kit (Human) (OKWB00214)

OKWB00214 96 Wells
EUR 572
Description: Description of target: Thought to form a receptor-activated non-selective calcium permeant cation channel. Probably is operated by a phosphatidylinositol second messenger system activated by receptor tyrosine kinases or G-protein coupled receptors. Seems to be also activated by intracellular calcium store depletion.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

TRPC1 sgRNA CRISPR Lentivector set (Human)

K2535001 3 x 1.0 ug
EUR 339

Trpc1 sgRNA CRISPR Lentivector set (Mouse)

K3814301 3 x 1.0 ug
EUR 339

Trpc1 sgRNA CRISPR Lentivector set (Rat)

K7024601 3 x 1.0 ug
EUR 339

TRPC1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2535002 1.0 ug DNA
EUR 154

TRPC1 sgRNA CRISPR Lentivector (Human) (Target 2)

K2535003 1.0 ug DNA
EUR 154

TRPC1 sgRNA CRISPR Lentivector (Human) (Target 3)

K2535004 1.0 ug DNA
EUR 154

Trpc1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3814302 1.0 ug DNA
EUR 154

Trpc1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3814303 1.0 ug DNA
EUR 154

Trpc1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3814304 1.0 ug DNA
EUR 154

Trpc1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7024602 1.0 ug DNA
EUR 154

Trpc1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7024603 1.0 ug DNA
EUR 154

Trpc1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7024604 1.0 ug DNA
EUR 154

TRPC1 Protein Vector (Human) (pPB-C-His)

PV059325 500 ng
EUR 481

TRPC1 Protein Vector (Human) (pPB-N-His)

PV059326 500 ng
EUR 481

TRPC1 Protein Vector (Human) (pPM-C-HA)

PV059327 500 ng
EUR 481

TRPC1 Protein Vector (Human) (pPM-C-His)

PV059328 500 ng
EUR 481

TRPC1 Protein Vector (Rat) (pPB-C-His)

PV313122 500 ng
EUR 1191

TRPC1 Protein Vector (Rat) (pPB-N-His)

PV313123 500 ng
EUR 1191

TRPC1 Protein Vector (Rat) (pPM-C-HA)

PV313124 500 ng
EUR 1191

TRPC1 Protein Vector (Rat) (pPM-C-His)

PV313125 500 ng
EUR 1191

TRPC1 Protein Vector (Mouse) (pPB-C-His)

PV241998 500 ng
EUR 1065

TRPC1 Protein Vector (Mouse) (pPB-N-His)

PV241999 500 ng
EUR 1065

TRPC1 Protein Vector (Mouse) (pPM-C-HA)

PV242000 500 ng
EUR 1065

TRPC1 Protein Vector (Mouse) (pPM-C-His)

PV242001 500 ng
EUR 1065

Trpc1 3'UTR GFP Stable Cell Line

TU171177 1.0 ml Ask for price

TRPC1 3'UTR GFP Stable Cell Line

TU077250 1.0 ml
EUR 1521

Trpc1 3'UTR Luciferase Stable Cell Line

TU121177 1.0 ml Ask for price

TRPC1 3'UTR Luciferase Stable Cell Line

TU027250 1.0 ml
EUR 1521

Trpc1 3'UTR Luciferase Stable Cell Line

TU222497 1.0 ml Ask for price

Trpc1 3'UTR GFP Stable Cell Line

TU272497 1.0 ml Ask for price

TRPC1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV692179 1.0 ug DNA
EUR 1355

TRPC1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV692183 1.0 ug DNA
EUR 1355

TRPC1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV692184 1.0 ug DNA
EUR 1355

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TRPC1 Rabbit Polyclonal Antibody