TRPC7 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

TRPC7 Polyclonal Antibody
ES10258-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRPC7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
TRPC7 Polyclonal Antibody
ABP60768-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein
TRPC7 Polyclonal Antibody
ABP60768-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein
TRPC7 Polyclonal Antibody
ABP60768-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein
TRPC7 Rabbit pAb
A17738-100ul 100 ul
EUR 308
TRPC7 Rabbit pAb
A17738-200ul 200 ul
EUR 459
TRPC7 Rabbit pAb
A17738-20ul 20 ul
EUR 183
TRPC7 Rabbit pAb
A17738-50ul 50 ul
EUR 223
Polyclonal TRPC7 (extracellular) Antibody
AMM08351G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPC7 (extracellular) . This antibody is tested and proven to work in the following applications:
TRPC7 Antibody
35976-100ul 100ul
EUR 252
TRPC7 Antibody
1-CSB-PA954426
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPC7. Recognizes TRPC7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
Polyclonal TRPC7 Antibody (internal region)
AMM08353G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRPC7 (internal region). This antibody is tested and proven to work in the following applications:
TRPC7
GT41031 100 ug
EUR 474
TRPC7 Conjugated Antibody
C35976 100ul
EUR 397
Anti-TRPC7 antibody
STJ71876 100 µg
EUR 359
Anti-TRPC7 antibody
STJ119779 100 µl
EUR 277
Anti-TRPC7 antibody
STJ191416 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRPC7
TRPC7 siRNA
20-abx938221
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRPC7 siRNA
20-abx938222
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Monoclonal antibody for TrpC7
SMC-343D 0.1mg
EUR 353
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is not conjugated.
Monoclonal antibody for TrpC7
SMC-343D-A390 0.1mg
EUR 400
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 390.
Monoclonal antibody for TrpC7
SMC-343D-A488 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 488.
Monoclonal antibody for TrpC7
SMC-343D-A565 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 565.
Monoclonal antibody for TrpC7
SMC-343D-A594 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 594.
Monoclonal antibody for TrpC7
SMC-343D-A633 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 633.
Monoclonal antibody for TrpC7
SMC-343D-A655 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 655.
Monoclonal antibody for TrpC7
SMC-343D-A680 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 680.
Monoclonal antibody for TrpC7
SMC-343D-A700 0.1mg
EUR 399
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 700.
Monoclonal antibody for TrpC7
SMC-343D-ALP 0.1mg
EUR 393
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Alkaline Phosphatase.
Monoclonal antibody for TrpC7
SMC-343D-APC 0.1mg
EUR 398
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with APC.
Monoclonal antibody for TrpC7
SMC-343D-APCCY7 0.1mg
EUR 470
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with APC/Cy7.
Monoclonal antibody for TrpC7
SMC-343D-BI 0.1mg
EUR 395
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Biotin.
Monoclonal antibody for TrpC7
SMC-343D-DY350 0.1mg
EUR 413
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 350.
Monoclonal antibody for TrpC7
SMC-343D-DY405 0.1mg
EUR 402
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 405.
Monoclonal antibody for TrpC7
SMC-343D-DY488 0.1mg
EUR 392
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 488.
Monoclonal antibody for TrpC7
SMC-343D-DY594 0.1mg
EUR 394
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 594.
Monoclonal antibody for TrpC7
SMC-343D-DY633 0.1mg
EUR 389
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 633.
Monoclonal antibody for TrpC7
SMC-343D-FITC 0.1mg
EUR 391
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with FITC.
Monoclonal antibody for TrpC7
SMC-343D-HRP 0.1mg
EUR 387
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with HRP.
Monoclonal antibody for TrpC7
SMC-343D-P594 0.1mg
EUR 406
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with PE/ATTO 594.
Monoclonal antibody for TrpC7
SMC-343D-PCP 0.1mg
EUR 398
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with PerCP.
Monoclonal antibody for TrpC7
SMC-343D-RPE 0.1mg
EUR 396
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with RPE.
Monoclonal antibody for TrpC7
SMC-343D-STR 0.1mg
EUR 397
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Streptavidin.
Monoclonal antibody for TrpC7
SMC-343S 0.012mg
EUR 65
  • Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
  • Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is not conjugated.
TRPC7 cloning plasmid
CSB-CL888031HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2589
  • Sequence: ATGTTGAGGAACAGCACCTTCAAAAACATGCAGCGCCGGCACACAACGCTGAGGGAGAAGGGCCGTCGCCAGGCCATCCGGGGTCCCGCCTACATGTTCAACGAGAAGGGCACCAGTCTGACGCCCGAGGAGGAGCGCTTCCTGGACTCGGCTGAGTATGGCAACATCCCGGTGG
  • Show more
Description: A cloning plasmid for the TRPC7 gene.
Anti-TRP 7/TRPC7 Antibody
PB9272 100ug/vial
EUR 294
Mouse TRPC7 shRNA Plasmid
20-abx973801
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TRPC7 ELISA KIT
ELI-23166h 96 Tests
EUR 824
Mouse Trpc7 ELISA KIT
ELI-40252m 96 Tests
EUR 865
Human TRPC7 shRNA Plasmid
20-abx961329
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Trpc7 ORF Vector (Rat) (pORF)
ORF078288 1.0 ug DNA
EUR 506
TRPC7 ORF Vector (Human) (pORF)
ORF014834 1.0 ug DNA
EUR 354
Trpc7 ORF Vector (Mouse) (pORF)
ORF060511 1.0 ug DNA
EUR 506
TRPC7 sgRNA CRISPR Lentivector set (Human)
K2535801 3 x 1.0 ug
EUR 339
Trpc7 sgRNA CRISPR Lentivector set (Mouse)
K3756701 3 x 1.0 ug
EUR 339
Trpc7 sgRNA CRISPR Lentivector set (Rat)
K7338001 3 x 1.0 ug
EUR 339
TRPC7-AS1 ORF Vector (Human) (pORF)
ORF035167 1.0 ug DNA Ask for price
TRPC7-AS2 ORF Vector (Human) (pORF)
ORF035168 1.0 ug DNA Ask for price
TRPC7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2535802 1.0 ug DNA
EUR 154
TRPC7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2535803 1.0 ug DNA
EUR 154
TRPC7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2535804 1.0 ug DNA
EUR 154
Trpc7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3756702 1.0 ug DNA
EUR 154
Trpc7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3756703 1.0 ug DNA
EUR 154
Trpc7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3756704 1.0 ug DNA
EUR 154
Trpc7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7338002 1.0 ug DNA
EUR 154
Trpc7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7338003 1.0 ug DNA
EUR 154
Trpc7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7338004 1.0 ug DNA
EUR 154
TRPC7 Protein Vector (Human) (pPB-C-His)
PV059333 500 ng
EUR 481
TRPC7 Protein Vector (Human) (pPB-N-His)
PV059334 500 ng
EUR 481
TRPC7 Protein Vector (Human) (pPM-C-HA)
PV059335 500 ng
EUR 481
TRPC7 Protein Vector (Human) (pPM-C-His)
PV059336 500 ng
EUR 481
TRPC7 Protein Vector (Rat) (pPB-C-His)
PV313150 500 ng
EUR 1166
TRPC7 Protein Vector (Rat) (pPB-N-His)
PV313151 500 ng
EUR 1166
TRPC7 Protein Vector (Rat) (pPM-C-HA)
PV313152 500 ng
EUR 1166
TRPC7 Protein Vector (Rat) (pPM-C-His)
PV313153 500 ng
EUR 1166
TRPC7 Protein Vector (Mouse) (pPB-C-His)
PV242042 500 ng
EUR 1065
TRPC7 Protein Vector (Mouse) (pPB-N-His)
PV242043 500 ng
EUR 1065
TRPC7 Protein Vector (Mouse) (pPM-C-HA)
PV242044 500 ng
EUR 1065
TRPC7 Protein Vector (Mouse) (pPM-C-His)
PV242045 500 ng
EUR 1065
Trpc7 3'UTR GFP Stable Cell Line
TU171184 1.0 ml Ask for price
TRPC7 3'UTR GFP Stable Cell Line
TU077258 1.0 ml
EUR 1394
Trpc7 3'UTR Luciferase Stable Cell Line
TU121184 1.0 ml Ask for price
TRPC7 3'UTR Luciferase Stable Cell Line
TU027258 1.0 ml
EUR 1394
Trpc7 3'UTR Luciferase Stable Cell Line
TU222504 1.0 ml Ask for price
Trpc7 3'UTR GFP Stable Cell Line
TU272504 1.0 ml Ask for price
TRPC7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV633367 1.0 ug DNA
EUR 1355
TRPC7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV633371 1.0 ug DNA
EUR 1355
TRPC7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV633372 1.0 ug DNA
EUR 1355
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TRPC7 Rabbit Polyclonal Antibody