TRPV5 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
TRPV5 Polyclonal Antibody |
ABP60772-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TRPV5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRPV5 from Human, Mouse, Rat. This TRPV5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV5 protein |
TRPV5 Polyclonal Antibody |
ABP60772-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TRPV5 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRPV5 from Human, Mouse, Rat. This TRPV5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV5 protein |
TRPV5 Polyclonal Antibody |
ES10390-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against TRPV5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TRPV5 Polyclonal Antibody |
ES10390-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TRPV5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TRPV5 Rabbit pAb |
A6473-100ul |
Abclonal |
100 ul |
EUR 308 |
TRPV5 Rabbit pAb |
A6473-200ul |
Abclonal |
200 ul |
EUR 459 |
TRPV5 Rabbit pAb |
A6473-20ul |
Abclonal |
20 ul |
EUR 183 |
TRPV5 Rabbit pAb |
A6473-50ul |
Abclonal |
50 ul |
EUR 223 |
TRPV5 antibody |
38948-100ul |
SAB |
100ul |
EUR 252 |
TRPV5 Antibody |
43169-100ul |
SAB |
100ul |
EUR 252 |
TRPV5 Antibody |
1-CSB-PA885690ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against TRPV5. Recognizes TRPV5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
TRPV5 Antibody |
1-CSB-PA909076 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRPV5. Recognizes TRPV5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
TRPV5 Antibody |
1-CSB-PA182372 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRPV5. Recognizes TRPV5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
TRPV5 antibody |
70R-5176 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal TRPV5 antibody raised against the N terminal of TRPV5 |
Polyclonal Goat Anti-TRPV5 Antibody |
AMM05147G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TRPV5 . This antibody is tested and proven to work in the following applications: |
Anti-TRPV5 Antibody |
A03218-1 |
BosterBio |
100ug/vial |
EUR 334 |
TRPV5 Conjugated Antibody |
C38948 |
SAB |
100ul |
EUR 397 |
anti- TRPV5 antibody |
FNab09029 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: IF: 1:10-1:100
- Immunogen: transient receptor potential cation channel, subfamily V, member 5
- Uniprot ID: Q9NQA5
- Gene ID: 56302
- Research Area: Epigenetics, Metabolism
|
Description: Antibody raised against TRPV5 |
Anti-TRPV5 Antibody |
PB9518 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-TRPV5 antibody |
STJ28556 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level. |
Anti-TRPV5 antibody |
STJ191548 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TRPV5 |
TRPV5 siRNA |
20-abx905817 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRPV5 siRNA |
20-abx938248 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRPV5 siRNA |
20-abx938249 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TRPV5 |
YF-PA26419 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to TRPV5 |
TRPV5 Blocking Peptide |
33R-6206 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRPV5 antibody, catalog no. 70R-5176 |
TRPV5 cloning plasmid |
CSB-CL885690HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1146
- Sequence: atggggggttttctacctaaggcagaagggcccgggagccaactccagaaacttctgccctcctttctggtcagagaacaagactgggaccagcacctggacaagcttcatatgctgcagcagaagaggattctagagtctccactgcttcgagcatccaaggaaaatgacctgt
- Show more
|
Description: A cloning plasmid for the TRPV5 gene. |
Anti-TRPV5 (2A6) |
YF-MA18952 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRPV5 |
Anti-TRPV5 (6D6) |
YF-MA18953 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to TRPV5 |
Rat TRPV5 shRNA Plasmid |
20-abx987249 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TRPV5 shRNA Plasmid |
20-abx961133 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse TRPV5 shRNA Plasmid |
20-abx980467 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
TRPV5 Recombinant Protein (Rat) |
RP234902 |
ABM |
100 ug |
Ask for price |
TRPV5 Recombinant Protein (Human) |
RP033085 |
ABM |
100 ug |
Ask for price |
TRPV5 Rabbit Polyclonal Antibody