TRPV5 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

TRPV5 Polyclonal Antibody
ABP60772-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human TRPV5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV5 from Human, Mouse, Rat. This TRPV5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV5 protein
TRPV5 Polyclonal Antibody
ABP60772-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human TRPV5 protein
  • Applications tips:
Description: A polyclonal antibody for detection of TRPV5 from Human, Mouse, Rat. This TRPV5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPV5 protein
TRPV5 Polyclonal Antibody
ES10390-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TRPV5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TRPV5 Polyclonal Antibody
ES10390-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TRPV5 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
TRPV5 Rabbit pAb
A6473-100ul 100 ul
EUR 308
TRPV5 Rabbit pAb
A6473-200ul 200 ul
EUR 459
TRPV5 Rabbit pAb
A6473-20ul 20 ul
EUR 183
TRPV5 Rabbit pAb
A6473-50ul 50 ul
EUR 223
TRPV5 antibody
38948-100ul 100ul
EUR 252
TRPV5 Antibody
43169-100ul 100ul
EUR 252
TRPV5 Antibody
1-CSB-PA885690ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TRPV5. Recognizes TRPV5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
TRPV5 Antibody
1-CSB-PA909076
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPV5. Recognizes TRPV5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TRPV5 Antibody
1-CSB-PA182372
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPV5. Recognizes TRPV5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
TRPV5 antibody
70R-5176 50 ug
EUR 467
Description: Rabbit polyclonal TRPV5 antibody raised against the N terminal of TRPV5
Polyclonal Goat Anti-TRPV5 Antibody
AMM05147G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-TRPV5 . This antibody is tested and proven to work in the following applications:
Trpv5/ Rat Trpv5 ELISA Kit
ELI-28433r 96 Tests
EUR 886
Anti-TRPV5 Antibody
A03218-1 100ug/vial
EUR 334
TRPV5 Conjugated Antibody
C38948 100ul
EUR 397
anti- TRPV5 antibody
FNab09029 100µg
EUR 548.75
  • Recommended dilution: IF: 1:10-1:100
  • Immunogen: transient receptor potential cation channel, subfamily V, member 5
  • Uniprot ID: Q9NQA5
  • Gene ID: 56302
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against TRPV5
Anti-TRPV5 antibody
PAab09029 100 ug
EUR 386
Anti-TRPV5 Antibody
PB9518 100ug/vial
EUR 294
Anti-TRPV5 antibody
STJ28556 100 µl
EUR 277
Description: This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level.
Anti-TRPV5 antibody
STJ71557 100 µg
EUR 359
Anti-TRPV5 antibody
STJ191548 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to TRPV5
TRPV5 siRNA
20-abx905817
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRPV5 siRNA
20-abx938248
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TRPV5 siRNA
20-abx938249
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TRPV5
YF-PA26419 50 ul
EUR 334
Description: Mouse polyclonal to TRPV5
Anti-TRPV5, Biotinylated antibody
STJ73235 100 µg
EUR 359
TRPV5 Blocking Peptide
33R-6206 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRPV5 antibody, catalog no. 70R-5176
TRPV5 cloning plasmid
CSB-CL885690HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1146
  • Sequence: atggggggttttctacctaaggcagaagggcccgggagccaactccagaaacttctgccctcctttctggtcagagaacaagactgggaccagcacctggacaagcttcatatgctgcagcagaagaggattctagagtctccactgcttcgagcatccaaggaaaatgacctgt
  • Show more
Description: A cloning plasmid for the TRPV5 gene.
pENTR223-TRPV5 vector
PVT12029 2 ug
EUR 308
Anti-TRPV5 (2A6)
YF-MA18952 100 ug
EUR 363
Description: Mouse monoclonal to TRPV5
Anti-TRPV5 (6D6)
YF-MA18953 100 ug
EUR 363
Description: Mouse monoclonal to TRPV5
Mouse Trpv5 ELISA KIT
ELI-16586m 96 Tests
EUR 865
Human TRPV5 ELISA KIT
ELI-28935h 96 Tests
EUR 824
TRPV5 ELISA KIT|Human
EF003874 96 Tests
EUR 689
Rat TRPV5 shRNA Plasmid
20-abx987249
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TRPV5 shRNA Plasmid
20-abx961133
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TRPV5 shRNA Plasmid
20-abx980467
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TRPV5 Recombinant Protein (Rat)
RP234902 100 ug Ask for price
TRPV5 Recombinant Protein (Human)
RP033085 100 ug Ask for price

TRPV5 Rabbit Polyclonal Antibody