ULK4 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

ULK4 Polyclonal Antibody
ABP60854-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ULK4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ULK4 from Human, Mouse. This ULK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ULK4 protein
ULK4 Polyclonal Antibody
ABP60854-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ULK4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ULK4 from Human, Mouse. This ULK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ULK4 protein
ULK4 Polyclonal Antibody
ABP60854-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ULK4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of ULK4 from Human, Mouse. This ULK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ULK4 protein
ULK4 Polyclonal Antibody
ES10217-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ULK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
ULK4 Polyclonal Antibody
ES10217-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ULK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
ULK4 Rabbit pAb
A7471-100ul 100 ul
EUR 308
ULK4 Rabbit pAb
A7471-200ul 200 ul
EUR 459
ULK4 Rabbit pAb
A7471-20ul 20 ul
EUR 183
ULK4 Rabbit pAb
A7471-50ul 50 ul
EUR 223
ULK4 Antibody
43614-100ul 100ul
EUR 252
ULK4 Antibody
1-CSB-PA853394ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ULK4. Recognizes ULK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
ULK4 Antibody
1-CSB-PA853394ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ULK4. Recognizes ULK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
ULK4 Antibody
DF9891 200ul
EUR 304
Description: ULK4 Antibody detects endogenous levels of total ULK4.
ULK4 Antibody
ABD9891 100 ug
EUR 438
Polyclonal ULK4 Antibody (C-Terminus)
AMM08433G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ULK4 (C-Terminus). This antibody is tested and proven to work in the following applications:
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody
20-abx006976
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody
abx122774-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody
20-abx320936
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody
20-abx320937
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
ULK4 Conjugated Antibody
C43614 100ul
EUR 397
Anti-ULK4 antibody
STJ29607 100 µl
EUR 277
Description: This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15.
Anti-ULK4 antibody
STJ191375 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ULK4
Anti-ULK4 Antibody
STJ503470 100 µg
EUR 476
ULK4 siRNA
20-abx939011
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ULK4 siRNA
20-abx939012
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-ULK4
YF-PA19493 50 ul
EUR 363
Description: Mouse polyclonal to ULK4
anti-ULK4
YF-PA19494 100 ug
EUR 403
Description: Rabbit polyclonal to ULK4
Anti-ULK4 Antibody (Biotin)
STJ503471 100 µg
EUR 586
Anti-ULK4 Antibody (FITC)
STJ503472 100 µg
EUR 586
ULK4 Blocking Peptide
DF9891-BP 1mg
EUR 195
ULK4 cloning plasmid
CSB-CL853394HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1743
  • Sequence: atggaaaactttattctgtatgaggagatcggaagaggaagcaagactgttgtctataaagggcgacggaagggaacaatcaattttgtagccattctttgtactgataagtgcaaaaggcctgaaataaccaactgggtccgtctcacccgtgaaataaaacacaagaatattg
  • Show more
Description: A cloning plasmid for the ULK4 gene.
pCMV-SPORT6-ULK4
PVT13821 2 ug
EUR 391
Mouse Serine/threonine- protein kinase ULK4, Ulk4 ELISA KIT
ELI-51201m 96 Tests
EUR 865
Human Serine/threonine- protein kinase ULK4, ULK4 ELISA KIT
ELI-44741h 96 Tests
EUR 824
Human ULK4 shRNA Plasmid
20-abx960382
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ULK4 shRNA Plasmid
20-abx980592
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-ULK4 (4A10-1A7)
YF-MA18713 100 ug
EUR 363
Description: Mouse monoclonal to ULK4
Ulk4 ORF Vector (Mouse) (pORF)
ORF061031 1.0 ug DNA
EUR 506
h ULK4 inducible lentiviral particles
LVP164 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, ULK4 , is fully sequence verified and matched to NCBI accession ID: NM_017886.2
ULK4 ORF Vector (Human) (pORF)
ORF011322 1.0 ug DNA
EUR 95
Monoclonal ULK4 Antibody (monoclonal) (M01), Clone: 4A10-1A7
AMM08434G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human ULK4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A10-1A7. This antibody is applicable in WB, E
Ulk4 sgRNA CRISPR Lentivector set (Mouse)
K3603101 3 x 1.0 ug
EUR 339
ULK4 sgRNA CRISPR Lentivector set (Human)
K2587701 3 x 1.0 ug
EUR 339
ULK4-IT1 ORF Vector (Human) (pORF)
ORF035491 1.0 ug DNA Ask for price
Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3603102 1.0 ug DNA
EUR 154
Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3603103 1.0 ug DNA
EUR 154
Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3603104 1.0 ug DNA
EUR 154
ULK4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2587702 1.0 ug DNA
EUR 154
ULK4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2587703 1.0 ug DNA
EUR 154
ULK4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2587704 1.0 ug DNA
EUR 154
ULK4 Protein Vector (Mouse) (pPB-C-His)
PV244122 500 ng
EUR 1065
ULK4 Protein Vector (Mouse) (pPB-N-His)
PV244123 500 ng
EUR 1065
ULK4 Protein Vector (Mouse) (pPM-C-HA)
PV244124 500 ng
EUR 1065
ULK4 Protein Vector (Mouse) (pPM-C-His)
PV244125 500 ng
EUR 1065
ULK4 Protein Vector (Human) (pPB-C-His)
PV045285 500 ng
EUR 329
ULK4 Protein Vector (Human) (pPB-N-His)
PV045286 500 ng
EUR 329
ULK4 Protein Vector (Human) (pPM-C-HA)
PV045287 500 ng
EUR 329
ULK4 Protein Vector (Human) (pPM-C-His)
PV045288 500 ng
EUR 329
Ulk4 3'UTR Luciferase Stable Cell Line
TU121577 1.0 ml Ask for price
ULK4 3'UTR GFP Stable Cell Line
TU077824 1.0 ml
EUR 1394
Ulk4 3'UTR GFP Stable Cell Line
TU171577 1.0 ml Ask for price
ULK4 3'UTR Luciferase Stable Cell Line
TU027824 1.0 ml
EUR 1394
ULK4-IT1 Protein Vector (Human) (pPB-C-His)
PV141962 500 ng Ask for price
ULK4-IT1 Protein Vector (Human) (pPB-N-His)
PV141963 500 ng Ask for price
ULK4-IT1 Protein Vector (Human) (pPM-C-HA)
PV141964 500 ng Ask for price
ULK4-IT1 Protein Vector (Human) (pPM-C-His)
PV141965 500 ng Ask for price
ULK4-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV755189 1.0 ug DNA Ask for price
ULK4-IT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV755193 1.0 ug DNA Ask for price
ULK4-IT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV755194 1.0 ug DNA Ask for price
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

ULK4 Rabbit Polyclonal Antibody