ATP4B Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
ATP4B Polyclonal Antibody |
ABP57844-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ATP4B protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of ATP4B from Human, Mouse, Rat. This ATP4B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ATP4B protein at amino acid sequence of 160-240 |
ATP4B Polyclonal Antibody |
A53516 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
ATP4B Rabbit pAb |
A10106-100ul |
Abclonal |
100 ul |
EUR 308 |
ATP4B Rabbit pAb |
A10106-200ul |
Abclonal |
200 ul |
EUR 459 |
ATP4B Rabbit pAb |
A10106-20ul |
Abclonal |
20 ul |
EUR 183 |
ATP4B Rabbit pAb |
A10106-50ul |
Abclonal |
50 ul |
EUR 223 |
ATP4B antibody |
70R-6951 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal ATP4B antibody raised against the middle region of ATP4B |
Atp4b antibody |
70R-8600 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Atp4b antibody |
ATP4B Antibody |
35648-100ul |
SAB |
100ul |
EUR 252 |
ATP4B antibody |
70R-15905 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ATP4B antibody |
ATP4B Antibody |
1-CSB-PA002343EA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
ATP4B Antibody |
1-CSB-PA002343GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
ATP4B Antibody |
1-CSB-PA017108 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
Polyclonal ATP4B Antibody (N-term) |
APR10860G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ATP4B (N-term). This antibody is tested and proven to work in the following applications: |
ATP4B Polyclonal Antibody, Biotin Conjugated |
A53513 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
ATP4B Polyclonal Antibody, FITC Conjugated |
A53514 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
ATP4B Polyclonal Antibody, HRP Conjugated |
A53515 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
DLR-ATP4b-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) in samples from tissue homogenates or other biological fluids. |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RD-ATP4b-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) ELISA Kit |
RDR-ATP4b-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
ATP4B Conjugated Antibody |
C35648 |
SAB |
100ul |
EUR 397 |
anti- ATP4B antibody |
FNab00701 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: ATPase, H+/K+ exchanging, beta polypeptide
- Uniprot ID: P51164
- Gene ID: 496
- Research Area: Metabolism
|
Description: Antibody raised against ATP4B |
Anti-ATP4B antibody |
STJ112145 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes the beta subunit of the gastric H+, K+-ATPase. |
Anti-ATP4B antibody |
STJ191197 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ATP4B |
ATP4B siRNA |
20-abx900522 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP4B siRNA |
20-abx908558 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP4B siRNA |
20-abx908559 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATP4B Antibody, HRP conjugated |
1-CSB-PA002343EB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ATP4B Antibody, FITC conjugated |
1-CSB-PA002343EC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ATP4B Antibody, Biotin conjugated |
1-CSB-PA002343ED01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ATP4B. Recognizes ATP4B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Atp4b Blocking Peptide |
33R-7677 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Atp4b antibody, catalog no. 70R-8600 |
ATP4B Blocking Peptide |
33R-7776 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ATP4B antibody, catalog no. 70R-6951 |
ATP4B cloning plasmid |
CSB-CL002343HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 876
- Sequence: atggcggctctgcaggagaagaagacgtgtggccagcgcatggaggagttccagcgttactgctggaacccggacacggggcagatgctgggccgcaccctgtcccggtgggtgtggatcagcctgtactacgtggccttctacgtggtgatgactgggctcttcgccctgtgcct
- Show more
|
Description: A cloning plasmid for the ATP4B gene. |
Rabbit Potassium- transporting ATPase subunit beta, ATP4B ELISA |
ELI-34316Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Rat ATP4B shRNA Plasmid |
20-abx984385 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ATP4B shRNA Plasmid |
20-abx950349 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ATP4B shRNA Plasmid |
20-abx969274 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ATP4B Recombinant Protein (Human) |
RP002296 |
ABM |
100 ug |
Ask for price |
ATP4B Recombinant Protein (Rat) |
RP191456 |
ABM |
100 ug |
Ask for price |
ATP4B Recombinant Protein (Mouse) |
RP117971 |
ABM |
100 ug |
Ask for price |
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit |
E04P0799-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit |
E04P0799-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Potassium transporting ATPase subunit β(ATP4B) ELISA kit |
E04P0799-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium transporting ATPase subunit β(ATP4B) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Anti-Hydrogen Potassium ATPase Beta/ATP4B Antibody |
A08719-1 |
BosterBio |
100ug/vial |
EUR 294 |
ATP4B ORF Vector (Human) (pORF) |
ORF000766 |
ABM |
1.0 ug DNA |
EUR 95 |
Atp4b ORF Vector (Mouse) (pORF) |
ORF039325 |
ABM |
1.0 ug DNA |
EUR 506 |
Atp4b ORF Vector (Rat) (pORF) |
ORF063820 |
ABM |
1.0 ug DNA |
EUR 506 |
ATP4b ELISA Kit (Mouse) (OKDD00766) |
OKDD00766 |
Aviva Systems Biology |
96 Wells |
EUR 988 |
Description: Description of target: Required for stabilization and maturation of the catalytic proton pump alpha subunit and may also involved in cell adhesion and establishing epithelial cell polarity.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.066ng/mL |
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
20-abx111155 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
20-abx110108 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
20-abx136016 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
abx037938-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
abx032433-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
abx032433-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody |
20-abx175505 |
Abbexa |
|
|
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4b) Antibody |
20-abx175506 |
Abbexa |
|
|
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
20-abx214013 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody |
abx230701-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
ATP4B sgRNA CRISPR Lentivector set (Human) |
K0146701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Atp4b sgRNA CRISPR Lentivector set (Mouse) |
K3780701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Atp4b sgRNA CRISPR Lentivector set (Rat) |
K6902401 |
ABM |
3 x 1.0 ug |
EUR 339 |
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (HRP) |
20-abx108624 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (Biotin) |
20-abx105786 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATPase, H+/K+ Exchanging Beta Polypeptide (ATP4B) Antibody (FITC) |
20-abx107204 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ATP4B sgRNA CRISPR Lentivector (Human) (Target 1) |
K0146702 |
ABM |
1.0 ug DNA |
EUR 154 |
ATP4B sgRNA CRISPR Lentivector (Human) (Target 2) |
K0146703 |
ABM |
1.0 ug DNA |
EUR 154 |
ATP4B sgRNA CRISPR Lentivector (Human) (Target 3) |
K0146704 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Potassium-transporting ATPase subunit beta (ATP4B) |
1-CSB-YP002343HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 28.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in Yeast |
Human Potassium-transporting ATPase subunit beta (ATP4B) |
1-CSB-EP002343HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 53.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),partial expressed in E.coli |
Human Potassium-transporting ATPase subunit beta (ATP4B) |
1-CSB-EP002343HUe1 |
Cusabio |
-
EUR 496.00
-
EUR 330.00
-
EUR 1425.00
-
EUR 677.00
-
EUR 989.00
-
EUR 378.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 26.6 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Potassium-transporting ATPase subunit beta(ATP4B),Partial expressed in E.coli |
Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3780702 |
ABM |
1.0 ug DNA |
EUR 154 |
Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3780703 |
ABM |
1.0 ug DNA |
EUR 154 |
Atp4b sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3780704 |
ABM |
1.0 ug DNA |
EUR 154 |
ATP4B Protein Vector (Human) (pPB-C-His) |
PV003061 |
ABM |
500 ng |
EUR 329 |
ATP4B Protein Vector (Human) (pPB-N-His) |
PV003062 |
ABM |
500 ng |
EUR 329 |
ATP4B Protein Vector (Human) (pPM-C-HA) |
PV003063 |
ABM |
500 ng |
EUR 329 |
ATP4B Protein Vector (Human) (pPM-C-His) |
PV003064 |
ABM |
500 ng |
EUR 329 |
Atp4b sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6902402 |
ABM |
1.0 ug DNA |
EUR 154 |
Atp4b sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6902403 |
ABM |
1.0 ug DNA |
EUR 154 |
Atp4b sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6902404 |
ABM |
1.0 ug DNA |
EUR 154 |
ATP4B Protein Vector (Human) (pPB-His-MBP) |
PV325046 |
ABM |
500 ng |
EUR 329 |
ATP4B Protein Vector (Human) (pPB-His-GST) |
PV325047 |
ABM |
500 ng |
EUR 329 |
ATP4B Protein Vector (Rat) (pPB-C-His) |
PV255278 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Rat) (pPB-N-His) |
PV255279 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Rat) (pPM-C-HA) |
PV255280 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Rat) (pPM-C-His) |
PV255281 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Mouse) (pPB-C-His) |
PV157298 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Mouse) (pPB-N-His) |
PV157299 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Mouse) (pPM-C-HA) |
PV157300 |
ABM |
500 ng |
EUR 603 |
ATP4B Protein Vector (Mouse) (pPM-C-His) |
PV157301 |
ABM |
500 ng |
EUR 603 |
Atp4b 3'UTR Luciferase Stable Cell Line |
TU201076 |
ABM |
1.0 ml |
Ask for price |
Atp4b 3'UTR GFP Stable Cell Line |
TU152320 |
ABM |
1.0 ml |
Ask for price |
ATP4B 3'UTR Luciferase Stable Cell Line |
TU001389 |
ABM |
1.0 ml |
EUR 1394 |
Atp4b 3'UTR Luciferase Stable Cell Line |
TU102320 |
ABM |
1.0 ml |
Ask for price |
ATP4B 3'UTR GFP Stable Cell Line |
TU051389 |
ABM |
1.0 ml |
EUR 1394 |
Atp4b 3'UTR GFP Stable Cell Line |
TU251076 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATP4B Rabbit Polyclonal Antibody