CCL25 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
CCL25 Polyclonal Antibody |
ES10267-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CCL25 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
CCL25 Polyclonal Antibody |
ABP58014-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110 |
CCL25 Polyclonal Antibody |
ABP58014-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110 |
CCL25 Polyclonal Antibody |
ABP58014-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of CCL25 from Human, Mouse. This CCL25 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CCL25 protein at amino acid sequence of 30-110 |
Ccl25 Polyclonal Antibody |
A53085 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
CCL25 Rabbit pAb |
A2685-100ul |
Abclonal |
100 ul |
EUR 308 |
CCL25 Rabbit pAb |
A2685-200ul |
Abclonal |
200 ul |
EUR 459 |
CCL25 Rabbit pAb |
A2685-20ul |
Abclonal |
20 ul |
EUR 183 |
CCL25 Rabbit pAb |
A2685-50ul |
Abclonal |
50 ul |
EUR 223 |
CCL25 Rabbit pAb |
A6543-100ul |
Abclonal |
100 ul |
EUR 308 |
CCL25 Rabbit pAb |
A6543-200ul |
Abclonal |
200 ul |
EUR 459 |
CCL25 Rabbit pAb |
A6543-20ul |
Abclonal |
20 ul |
EUR 183 |
CCL25 Rabbit pAb |
A6543-50ul |
Abclonal |
50 ul |
EUR 223 |
CCL25 antibody |
38996-100ul |
SAB |
100ul |
EUR 252 |
CCL25 Antibody |
42700-100ul |
SAB |
100ul |
EUR 252 |
CCL25 Antibody |
1-CSB-PA004789ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CCL25. Recognizes CCL25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Ccl25 Antibody |
1-CSB-PA09189A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA |
CCL25 Antibody |
1-CSB-PA118672 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CCL25. Recognizes CCL25 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
Ccl25 Polyclonal Antibody, Biotin Conjugated |
A53082 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Ccl25 Polyclonal Antibody, FITC Conjugated |
A53083 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Ccl25 Polyclonal Antibody, HRP Conjugated |
A53084 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
CCL25 Conjugated Antibody |
C38996 |
SAB |
100ul |
EUR 397 |
Anti-CCL25 antibody |
STJ28626 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. |
Anti-CCL25 antibody |
STJ116184 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. |
Anti-CCL25 antibody |
STJ191425 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to CCL25 |
CCL25 siRNA |
20-abx910776 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CCL25 siRNA |
20-abx910777 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti- CCL25/TECK antibody |
FNab01381 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: chemokine(C-C motif) ligand 25
- Uniprot ID: O15444
- Gene ID: 6370
- Research Area: Immunology, Signal Transduction
|
Description: Antibody raised against CCL25/TECK |
Ccl25 Antibody, HRP conjugated |
1-CSB-PA09189B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
Ccl25 Antibody, FITC conjugated |
1-CSB-PA09189C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
Ccl25 Antibody, Biotin conjugated |
1-CSB-PA09189D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Ccl25. Recognizes Ccl25 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CCL25 cloning plasmid |
CSB-CL004789HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 453
- Sequence: atgaacctgtggctcctggcctgcctggtggccggcttcctgggagcctgggcccccgctgtccacacccaaggtgtctttgaggactgctgcctggcctaccactaccccattgggtgggctgtgctccggcgcgcctggacttaccggatccaggaggtgagcgggagctgcaa
- Show more
|
Description: A cloning plasmid for the CCL25 gene. |
TECK, CCL25, human |
RC315-36 |
BBI Biotech |
5ug |
EUR 104.38 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
CCL25, murine (mouse) |
RC335-36 |
BBI Biotech |
5ug |
EUR 101.33 |
- Product category: Proteins/Recombinant Proteins/Cytokines
|
Thymus Expressed Chemokine (CCL25) Antibody |
abx231381-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Rabbit Thymus Expressed Chemokine / TECK (CCL25) ELISA Kit |
abx363170-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human CCL25 shRNA Plasmid |
20-abx954302 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CCL25 protein (His tag) |
80R-4131 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Recombinant Human CCL25 protein (His tag) |
TECK (CCL25), human recombinant |
7214-10 |
Biovision |
|
EUR 207 |
TECK (CCL25), human recombinant |
7214-50 |
Biovision |
|
EUR 675 |
Mouse CCL25 shRNA Plasmid |
20-abx972601 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
C-C Motif Chemokine 25 (CCL25) Antibody |
20-abx005022 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
C-C Motif Chemokine 25 (CCL25) Antibody |
20-abx005616 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
C-C Motif Chemokine 25 (CCL25) Antibody |
20-abx320184 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
C-C Motif Chemokine 25 (CCL25) Antibody |
abx412122-01mg |
Abbexa |
0.1 mg |
EUR 704 |
|
Recombinant Human TECK (CCL25) Protein |
PROTO15444-2 |
BosterBio |
20ug |
EUR 317 |
Description: TECK is a CC chemokine, specifically expressed by thymic stromal cells, and signals through the CCR9 receptor. TECK is chemotactic towards activated macrophages, thymocytes and dendritic cells. Recombinant human TECK is a 14.2 kDa protein containing 127 amino acid residues, including the four conserved cysteine residues present in CC chemokines. |
Ccl25 ORF Vector (Mouse) (pORF) |
ORF040692 |
ABM |
1.0 ug DNA |
EUR 506 |
CCL25 ORF Vector (Human) (pORF) |
ORF012615 |
ABM |
1.0 ug DNA |
EUR 354 |
Ccl25 ORF Vector (Rat) (pORF) |
ORF064552 |
ABM |
1.0 ug DNA |
EUR 506 |
CCL25 ELISA Kit (Human) (OKAN06540) |
OKAN06540 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 11.5 pg/mL |
Ccl25 ELISA Kit (Mouse) (OKBB00980) |
OKBB00980 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Chemokine (C-C motif) ligand 25 (CCL25) is a small cytokine belonging to the CC chemokine family that is also known as TECK (Thymus-Expressed Chemokine). The mouse Teck gene was mapped to chromosome 8 and human Teck gene was to 19p13.2. CCL25 is believed to play a role in the development of T-cells. It is chemotactic for thymocytes, macrophages, and dendritic cells. CCL25 elicits its effects by binding to the chemokine receptor CCR9.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
CCL25 ELISA Kit (Human) (OKCD07248) |
OKCD07248 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 11.5pg/mL |
Ccl25 ELISA Kit (Mouse) (OKEH04673) |
OKEH04673 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Potentially involved in T-cell development. Recombinant protein shows chemotactic activity on thymocytes, macrophages, THP-1 cells, and dendritics cells but is inactive on peripheral blood lymphocytes and neutrophils. Binds to CCR9. Binds to atypical chemokine receptor ACKR4 and mediates the recruitment of beta-arrestin (ARRB1/2) to ACKR4.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL |
CCL25 ELISA Kit (Human) (OKEH04674) |
OKEH04674 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 32 pg/mL |
CCL25 ELISA Kit (Pig) (OKEH06336) |
OKEH06336 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Potentially involved in T-cell development. Recombinant protein shows chemotactic activity on thymocytes, macrophages, THP-1 cells, and dendritics cells but is inactive on peripheral blood lymphocytes and neutrophils. Binds to CCR9. Binds to atypical chemokine receptor ACKR4 and mediates the recruitment of beta-arrestin (ARRB1/2) to ACKR4.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.069 ng/mL |
CCL25 ELISA Kit (Rat) (OKEI00859) |
OKEI00859 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL |
C-C Motif Chemokine Ligand 25 (CCL25) Antibody |
20-abx109626 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
C-C Motif Chemokine Ligand 25 (CCL25) Antibody |
20-abx210507 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse CCL25/TECK PicoKine ELISA Kit |
EK1424 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of mouse CCL25 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
ELISA kit for Mouse CCL25/TECK |
EK5665 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse CCL25/TECK in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human CCL25/TECK PicoKine ELISA Kit |
EK1145 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human CCL25 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA). |
CCL25 sgRNA CRISPR Lentivector set (Human) |
K0390801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Human Thymus Expressed Chemokine (CCL25) |
7-02125 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Thymus Expressed Chemokine (CCL25) |
7-02126 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Human Thymus Expressed Chemokine (CCL25) |
7-02127 |
CHI Scientific |
1mg |
Ask for price |
Recombinant Mouse Thymus Expressed Chemokine (CCL25) |
7-02128 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Mouse Thymus Expressed Chemokine (CCL25) |
7-02129 |
CHI Scientific |
20µg |
Ask for price |
Recombinant Mouse Thymus Expressed Chemokine (CCL25) |
7-02130 |
CHI Scientific |
1mg |
Ask for price |
Ccl25 sgRNA CRISPR Lentivector set (Mouse) |
K3914601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ccl25 sgRNA CRISPR Lentivector set (Rat) |
K7193801 |
ABM |
3 x 1.0 ug |
EUR 339 |
C-C Motif Chemokine Ligand 25 (CCL25) Antibody (Biotin) |
20-abx105239 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
C-C Motif Chemokine Ligand 25 (CCL25) Antibody (FITC) |
20-abx106657 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
C-C Motif Chemokine Ligand 25 (CCL25) Antibody (HRP) |
20-abx108074 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CCL25 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0390802 |
ABM |
1.0 ug DNA |
EUR 154 |
CCL25 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0390803 |
ABM |
1.0 ug DNA |
EUR 154 |
CCL25 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0390804 |
ABM |
1.0 ug DNA |
EUR 154 |
Mouse C-C motif chemokine 25 (Ccl25) |
1-CSB-RP091894m |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 18 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse C-C motif chemokine 25(Ccl25),partial expressed in E.coli |
Human C-C motif chemokine 25 (CCL25) |
1-CSB-EP004789HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 41.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human C-C motif chemokine 25(CCL25) expressed in E.coli |
Ccl25 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3914602 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccl25 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3914603 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccl25 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3914604 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccl25 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7193802 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccl25 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7193803 |
ABM |
1.0 ug DNA |
EUR 154 |
Ccl25 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7193804 |
ABM |
1.0 ug DNA |
EUR 154 |
CCL25 Protein Vector (Human) (pPB-C-His) |
PV050457 |
ABM |
500 ng |
EUR 481 |
CCL25 Protein Vector (Human) (pPB-N-His) |
PV050458 |
ABM |
500 ng |
EUR 481 |
CCL25 Protein Vector (Human) (pPM-C-HA) |
PV050459 |
ABM |
500 ng |
EUR 481 |
CCL25 Protein Vector (Human) (pPM-C-His) |
PV050460 |
ABM |
500 ng |
EUR 481 |
CCL25 Protein Vector (Rat) (pPB-C-His) |
PV258206 |
ABM |
500 ng |
EUR 603 |
CCL25 Protein Vector (Rat) (pPB-N-His) |
PV258207 |
ABM |
500 ng |
EUR 603 |
CCL25 Protein Vector (Rat) (pPM-C-HA) |
PV258208 |
ABM |
500 ng |
EUR 603 |
CCL25 Protein Vector (Rat) (pPM-C-His) |
PV258209 |
ABM |
500 ng |
EUR 603 |
CCL25 Protein Vector (Mouse) (pPB-C-His) |
PV162766 |
ABM |
500 ng |
EUR 603 |
CCL25 Protein Vector (Mouse) (pPB-N-His) |
PV162767 |
ABM |
500 ng |
EUR 603 |
CCL25 Protein Vector (Mouse) (pPM-C-HA) |
PV162768 |
ABM |
500 ng |
EUR 603 |
CCL25 Protein Vector (Mouse) (pPM-C-His) |
PV162769 |
ABM |
500 ng |
EUR 603 |
Ccl25 3'UTR Luciferase Stable Cell Line |
TU201867 |
ABM |
1.0 ml |
Ask for price |
Ccl25 3'UTR GFP Stable Cell Line |
TU153379 |
ABM |
1.0 ml |
Ask for price |
CCL25 3'UTR Luciferase Stable Cell Line |
TU003770 |
ABM |
1.0 ml |
EUR 1394 |
Ccl25 3'UTR Luciferase Stable Cell Line |
TU103379 |
ABM |
1.0 ml |
Ask for price |
CCL25 3'UTR GFP Stable Cell Line |
TU053770 |
ABM |
1.0 ml |
EUR 1394 |
Ccl25 3'UTR GFP Stable Cell Line |
TU251867 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CCL25 Rabbit Polyclonal Antibody