HCN3 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
HCN3 Polyclonal Antibody |
ES10036-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HCN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HCN3 Polyclonal Antibody |
ES10036-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HCN3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HCN3 Polyclonal Antibody |
ABP58761-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
- Applications tips:
|
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230 |
HCN3 Polyclonal Antibody |
ABP58761-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
- Applications tips:
|
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230 |
HCN3 Polyclonal Antibody |
ABP58761-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230
- Applications tips:
|
Description: A polyclonal antibody for detection of HCN3 from Human, Mouse, Rat. This HCN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HCN3 protein at amino acid sequence of 150-230 |
Polyclonal HCN3 (extracellular) Antibody |
APR12352G |
Leading Biology |
0.05ml |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCN3 (extracellular) . This antibody is tested and proven to work in the following applications: |
HCN3 antibody |
70R-5168 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal HCN3 antibody raised against the middle region of HCN3 |
HCN3 Antibody |
43682-100ul |
SAB |
100ul |
EUR 252 |
HCN3 antibody |
70R-17702 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal HCN3 antibody |
HCN3 Antibody |
DF9770 |
Affbiotech |
200ul |
EUR 304 |
Description: HCN3 Antibody detects endogenous levels of total HCN3. |
HCN3 Antibody |
1-CSB-PA010218GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against HCN3. Recognizes HCN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal HCN3 Antibody (internal region) |
APR12330G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HCN3 (internal region). This antibody is tested and proven to work in the following applications: |
Polyclonal HCN3 antibody - middle region |
APR12331G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HCN3 - middle region. This antibody is tested and proven to work in the following applications: |
HCN3 Conjugated Antibody |
C43682 |
SAB |
100ul |
EUR 397 |
anti- HCN3 antibody |
FNab03789 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:5000
- Immunogen: hyperpolarization activated cyclic nucleotide-gated potassium channel 3
- Uniprot ID: Q9P1Z3
- Gene ID: 57657
- Research Area: Cardiovascular
|
Description: Antibody raised against HCN3 |
Anti-HCN3 antibody |
STJ191194 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to HCN3 |
HCN3 siRNA |
20-abx902428 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HCN3 siRNA |
20-abx919159 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HCN3 siRNA |
20-abx919160 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Monoclonal antibody for HCN3 |
SMC-306D |
Stressmarq |
0.1mg |
EUR 353 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is not conjugated. |
Monoclonal antibody for HCN3 |
SMC-306D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 390. |
Monoclonal antibody for HCN3 |
SMC-306D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 488. |
Monoclonal antibody for HCN3 |
SMC-306D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 565. |
Monoclonal antibody for HCN3 |
SMC-306D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 594. |
Monoclonal antibody for HCN3 |
SMC-306D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 633. |
Monoclonal antibody for HCN3 |
SMC-306D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 655. |
Monoclonal antibody for HCN3 |
SMC-306D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 680. |
Monoclonal antibody for HCN3 |
SMC-306D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with ATTO 700. |
Monoclonal antibody for HCN3 |
SMC-306D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for HCN3 |
SMC-306D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with APC. |
Monoclonal antibody for HCN3 |
SMC-306D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with APC/Cy7. |
Monoclonal antibody for HCN3 |
SMC-306D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Biotin. |
Monoclonal antibody for HCN3 |
SMC-306D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 350. |
Monoclonal antibody for HCN3 |
SMC-306D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 405. |
Monoclonal antibody for HCN3 |
SMC-306D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 488. |
Monoclonal antibody for HCN3 |
SMC-306D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 594. |
Monoclonal antibody for HCN3 |
SMC-306D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Dylight 633. |
Monoclonal antibody for HCN3 |
SMC-306D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with FITC. |
Monoclonal antibody for HCN3 |
SMC-306D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with HRP. |
Monoclonal antibody for HCN3 |
SMC-306D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Mouse HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with PE/ATTO 594. |
Monoclonal antibody for HCN3 |
SMC-306D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with PerCP. |
Monoclonal antibody for HCN3 |
SMC-306D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with RPE. |
Monoclonal antibody for HCN3 |
SMC-306D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is conjugated with Streptavidin. |
Monoclonal antibody for HCN3 |
SMC-306S |
Stressmarq |
0.012mg |
EUR 65 |
- Hyperpolarization-activated cation channels of the HCN gene family contribute to spontaneous rhythmic activity in both the heart and brain (1).
|
Description: A monoclonal antibody from clone S141-28 against Human | Rat HCN3. The host species for the production of this antibody is Mouse. The antigen used for immunization is Mouse Fusion protein amino acids 660-779 (C terminus) of mouse HCN3. The antibody is tested and validated for WB, IHC, ICC/IF, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for HCN3 is not conjugated. |
Polyclonal HCN3 (aa 715-728) Antibody (internal region) |
APR12351G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HCN3 (aa 715-728) (internal region). This antibody is tested and proven to work in the following applications: |
HCN3 Blocking Peptide |
33R-5296 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HCN3 antibody, catalog no. 70R-5168 |
HCN3 cloning plasmid |
CSB-CL868385HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1341
- Sequence: atgctcagcatgatcgtaggtgccacatgctacgccatgttcatcggccatgccacggcactcatccagtccctggactcttcccggcgtcagtaccaggagaagtacaagcaggtggagcagtacatgtccttccacaagctgccagcagacacgcggcagcgcatccacgagt
- Show more
|
Description: A cloning plasmid for the HCN3 gene. |
HCN3 Blocking Peptide |
DF9770-BP |
Affbiotech |
1mg |
EUR 195 |
Rat HCN3 shRNA Plasmid |
20-abx987186 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse HCN3 shRNA Plasmid |
20-abx970766 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human HCN3 shRNA Plasmid |
20-abx961610 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HCN3 Recombinant Protein (Human) |
RP014485 |
ABM |
100 ug |
Ask for price |
HCN3 Recombinant Protein (Rat) |
RP204308 |
ABM |
100 ug |
Ask for price |
HCN3 Recombinant Protein (Mouse) |
RP141071 |
ABM |
100 ug |
Ask for price |
HCN3 ORF Vector (Human) (pORF) |
ORF004829 |
ABM |
1.0 ug DNA |
EUR 95 |
Hcn3 ORF Vector (Rat) (pORF) |
ORF068104 |
ABM |
1.0 ug DNA |
EUR 506 |
Hcn3 ORF Vector (Mouse) (pORF) |
ORF047025 |
ABM |
1.0 ug DNA |
EUR 506 |
HCN3 sgRNA CRISPR Lentivector set (Human) |
K0938301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hcn3 sgRNA CRISPR Lentivector set (Mouse) |
K5030201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hcn3 sgRNA CRISPR Lentivector set (Rat) |
K7115901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rabbit Anti-Mouse Hyperpolarization-activated Cyclic Nucleotide-gated channel 3 (HCN3) antiserum |
HCN31-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
HCN3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0938302 |
ABM |
1.0 ug DNA |
EUR 154 |
HCN3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0938303 |
ABM |
1.0 ug DNA |
EUR 154 |
HCN3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0938304 |
ABM |
1.0 ug DNA |
EUR 154 |
Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K5030202 |
ABM |
1.0 ug DNA |
EUR 154 |
Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K5030203 |
ABM |
1.0 ug DNA |
EUR 154 |
Hcn3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K5030204 |
ABM |
1.0 ug DNA |
EUR 154 |
Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7115902 |
ABM |
1.0 ug DNA |
EUR 154 |
Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7115903 |
ABM |
1.0 ug DNA |
EUR 154 |
Hcn3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7115904 |
ABM |
1.0 ug DNA |
EUR 154 |
HCN3 Protein Vector (Rat) (pPB-C-His) |
PV272414 |
ABM |
500 ng |
EUR 1166 |
HCN3 Protein Vector (Rat) (pPB-N-His) |
PV272415 |
ABM |
500 ng |
EUR 1166 |
HCN3 Protein Vector (Rat) (pPM-C-HA) |
PV272416 |
ABM |
500 ng |
EUR 1166 |
HCN3 Protein Vector (Rat) (pPM-C-His) |
PV272417 |
ABM |
500 ng |
EUR 1166 |
HCN3 Protein Vector (Human) (pPB-C-His) |
PV019313 |
ABM |
500 ng |
EUR 329 |
HCN3 Protein Vector (Human) (pPB-N-His) |
PV019314 |
ABM |
500 ng |
EUR 329 |
HCN3 Protein Vector (Human) (pPM-C-HA) |
PV019315 |
ABM |
500 ng |
EUR 329 |
HCN3 Protein Vector (Human) (pPM-C-His) |
PV019316 |
ABM |
500 ng |
EUR 329 |
HCN3 Protein Vector (Mouse) (pPB-C-His) |
PV188098 |
ABM |
500 ng |
EUR 1065 |
HCN3 Protein Vector (Mouse) (pPB-N-His) |
PV188099 |
ABM |
500 ng |
EUR 1065 |
HCN3 Protein Vector (Mouse) (pPM-C-HA) |
PV188100 |
ABM |
500 ng |
EUR 1065 |
HCN3 Protein Vector (Mouse) (pPM-C-His) |
PV188101 |
ABM |
500 ng |
EUR 1065 |
Hcn3 3'UTR Luciferase Stable Cell Line |
TU205674 |
ABM |
1.0 ml |
Ask for price |
Hcn3 3'UTR GFP Stable Cell Line |
TU159397 |
ABM |
1.0 ml |
Ask for price |
HCN3 3'UTR Luciferase Stable Cell Line |
TU009641 |
ABM |
1.0 ml |
EUR 1394 |
Hcn3 3'UTR Luciferase Stable Cell Line |
TU109397 |
ABM |
1.0 ml |
Ask for price |
HCN3 3'UTR GFP Stable Cell Line |
TU059641 |
ABM |
1.0 ml |
EUR 1394 |
Hcn3 3'UTR GFP Stable Cell Line |
TU255674 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HCN3 Rabbit Polyclonal Antibody