KCNE1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

KCNE1 Polyclonal Antibody
ABP59014-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of KCNE1 from Human, Mouse, Rat. This KCNE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120

KCNE1 Polyclonal Antibody
ABP59014-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of KCNE1 from Human, Mouse, Rat. This KCNE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KCNE1 protein at amino acid sequence of 40-120

KCNE1 Polyclonal Antibody
ES10025-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against KCNE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

KCNE1 Polyclonal Antibody
ES10025-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against KCNE1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

KCNE1 Rabbit pAb
A14009-100ul	Abclonal	100 ul	EUR 308

KCNE1 Rabbit pAb
A14009-200ul	Abclonal	200 ul	EUR 459

KCNE1 Rabbit pAb
A14009-20ul	Abclonal	20 ul	EUR 183

KCNE1 Rabbit pAb
A14009-50ul	Abclonal	50 ul	EUR 223

KCNE1 Rabbit pAb
A1176-100ul	Abclonal	100 ul	EUR 308

KCNE1 Rabbit pAb
A1176-200ul	Abclonal	200 ul	EUR 459

KCNE1 Rabbit pAb
A1176-20ul	Abclonal	20 ul	EUR 183

KCNE1 Rabbit pAb
A1176-50ul	Abclonal	50 ul	EUR 223

KCNE1 antibody
70R-18067	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal KCNE1 antibody

KCNE1 Antibody
32205-100ul	SAB	100ul	EUR 252

KCNE1 Antibody
DF6310	Affbiotech	200ul	EUR 304
Description: KCNE1 Antibody detects endogenous levels of total KCNE1.

KCNE1 Antibody
1-CSB-PA012025GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

KCNE1 Antibody
1-CSB-PA012025LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

KCNE1 Antibody
ABD6310	Lifescience Market	100 ug	EUR 438

KCNE1 Conjugated Antibody
C32205	SAB	100ul	EUR 397

anti- KCNE1 antibody
FNab04482	FN Test	100µg	EUR 505.25
Immunogen: potassium voltage-gated channel, Isk-related family, member 1 Uniprot ID: P15382 Gene ID: 3753 Research Area: Neuroscience, Cardiovascular
Description: Antibody raised against KCNE1

Anti-KCNE1 antibody
PAab04482	Lifescience Market	100 ug	EUR 355

Anti-KCNE1 antibody
STJ24291	St John's Laboratory	100 µl	EUR 277
Description: The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified.

Anti-KCNE1 antibody
STJ115944	St John's Laboratory	100 µl	EUR 277
Description: The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified.

Anti-KCNE1 antibody
STJ191183	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to KCNE1

Kcne1/ Rat Kcne1 ELISA Kit
ELI-47884r	Lifescience Market	96 Tests	EUR 886

KCNE1 siRNA
20-abx902780	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KCNE1 siRNA
20-abx921189	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KCNE1 siRNA
20-abx921190	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-KCNE1
YF-PA12825	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to KCNE1

anti-KCNE1
YF-PA12826	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to KCNE1

anti-KCNE1
YF-PA12827	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to KCNE1

anti-KCNE1
YF-PA24037	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to KCNE1

KCNE1 Antibody, HRP conjugated
1-CSB-PA012025LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

KCNE1 Antibody, FITC conjugated
1-CSB-PA012025LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

KCNE1 Antibody, Biotin conjugated
1-CSB-PA012025LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against KCNE1. Recognizes KCNE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

KCNE1 Blocking Peptide
DF6310-BP	Affbiotech	1mg	EUR 195

KCNE1 cloning plasmid
CSB-CL012025HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 318 Sequence: atgatcctgtctaacaccacagcggtgacgccctttctgaccaagctgtggcaggagacagttcagcagggtggcaacatgtcgggcctggcccacaggtccccccgcagcggtgacggcaagctggaggccctctacgtcctcatggtactgggattcttcggcttcttcaccct Show more
Description: A cloning plasmid for the KCNE1 gene.

Anti-KCNE1 (5B12)
YF-MA10497	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to KCNE1

Anti-KCNE1 (2A6)
YF-MA13905	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to KCNE1

Mouse Kcne1 ELISA KIT
ELI-15824m	Lifescience Market	96 Tests	EUR 865

Human KCNE1 ELISA KIT
ELI-28086h	Lifescience Market	96 Tests	EUR 824

KCNE1 ELISA KIT|Human
EF010448	Lifescience Market	96 Tests	EUR 689

Rat KCNE1 shRNA Plasmid
20-abx985052	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human KCNE1 shRNA Plasmid
20-abx952529	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse KCNE1 shRNA Plasmid
20-abx971144	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KCNE1 Recombinant Protein (Human)
RP016579	ABM	100 ug	Ask for price

KCNE1 Recombinant Protein (Rat)
RP206747	ABM	100 ug	Ask for price

KCNE1 Recombinant Protein (Mouse)
RP144986	ABM	100 ug	Ask for price

Monoclonal KCNE1 Antibody (monoclonal) (M01), Clone: 5B12
AMM06086G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human KCNE1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5B12. This antibody is applicable in WB, E

Monoclonal KCNE1 Antibody (monoclonal) (M13), Clone: 2A6
AMM06087G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human KCNE1 (monoclonal) (M13). The antibodies are raised in mouse and are from clone 2A6. This antibody is applicable in IP, E

Kcne1 ORF Vector (Rat) (pORF)
ORF068917	ABM	1.0 ug DNA	EUR 506

KCNE1 ORF Vector (Human) (pORF)
ORF005527	ABM	1.0 ug DNA	EUR 95

Kcne1 ORF Vector (Mouse) (pORF)
ORF048330	ABM	1.0 ug DNA	EUR 506

Kcne1 sgRNA CRISPR Lentivector set (Rat)
K6831501	ABM	3 x 1.0 ug	EUR 339

Kcne1 sgRNA CRISPR Lentivector set (Mouse)
K3368901	ABM	3 x 1.0 ug	EUR 339

KCNE1 sgRNA CRISPR Lentivector set (Human)
K1118301	ABM	3 x 1.0 ug	EUR 339

Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit
E04P0810-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit
E04P0810-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) ELISA kit
E04P0810-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Potassium voltage gated channel subfamily E member 1(KCNE1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6831502	ABM	1.0 ug DNA	EUR 154

Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6831503	ABM	1.0 ug DNA	EUR 154

Kcne1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6831504	ABM	1.0 ug DNA	EUR 154

Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3368902	ABM	1.0 ug DNA	EUR 154

Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3368903	ABM	1.0 ug DNA	EUR 154

Kcne1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3368904	ABM	1.0 ug DNA	EUR 154

KCNE1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1118302	ABM	1.0 ug DNA	EUR 154

KCNE1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1118303	ABM	1.0 ug DNA	EUR 154

KCNE1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1118304	ABM	1.0 ug DNA	EUR 154

KCNE1 Protein Vector (Human) (pPB-C-His)
PV022105	ABM	500 ng	EUR 329

KCNE1 Protein Vector (Human) (pPB-N-His)
PV022106	ABM	500 ng	EUR 329

KCNE1 Protein Vector (Human) (pPM-C-HA)
PV022107	ABM	500 ng	EUR 329

KCNE1 Protein Vector (Human) (pPM-C-His)
PV022108	ABM	500 ng	EUR 329

KCNE1 Protein Vector (Rat) (pPB-C-His)
PV275666	ABM	500 ng	EUR 603

KCNE1 Protein Vector (Rat) (pPB-N-His)
PV275667	ABM	500 ng	EUR 603

KCNE1 Protein Vector (Rat) (pPM-C-HA)
PV275668	ABM	500 ng	EUR 603

KCNE1 Protein Vector (Rat) (pPM-C-His)
PV275669	ABM	500 ng	EUR 603

KCNE1 Protein Vector (Mouse) (pPB-C-His)
PV193318	ABM	500 ng	EUR 603

KCNE1 Protein Vector (Mouse) (pPB-N-His)
PV193319	ABM	500 ng	EUR 603

KCNE1 Protein Vector (Mouse) (pPM-C-HA)
PV193320	ABM	500 ng	EUR 603

KCNE1 Protein Vector (Mouse) (pPM-C-His)
PV193321	ABM	500 ng	EUR 603

Kcne1 3'UTR Luciferase Stable Cell Line
TU110409	ABM	1.0 ml	Ask for price

Kcne1 3'UTR GFP Stable Cell Line
TU160409	ABM	1.0 ml	Ask for price

Kcne1 3'UTR Luciferase Stable Cell Line
TU206554	ABM	1.0 ml	Ask for price

Kcne1 3'UTR GFP Stable Cell Line
TU256554	ABM	1.0 ml	Ask for price

KCNE1 3'UTR GFP Stable Cell Line
TU061476	ABM	1.0 ml	EUR 4617

KCNE1 3'UTR Luciferase Stable Cell Line
TU011476	ABM	1.0 ml	EUR 4617

Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody
20-abx114637	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody
abx234482-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody
20-abx302181	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody
20-abx225257	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Potassium Voltage-Gated Channel Subfamily E Member 1 (KCNE1) Antibody
20-abx001090	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

KCNE1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV673873	ABM	1.0 ug DNA	EUR 514

KCNE1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV673877	ABM	1.0 ug DNA	EUR 514

KCNE1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV673878	ABM	1.0 ug DNA	EUR 514

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57464-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of HSP40 Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of HSP90? Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

KCNE1 Rabbit Polyclonal Antibody