NFIX Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NFIX Polyclonal Antibody
ABP59456-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310 Applications tips:
Description: A polyclonal antibody for detection of NFIX from Human, Mouse. This NFIX antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310

NFIX Polyclonal Antibody
ABP59456-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310 Applications tips:
Description: A polyclonal antibody for detection of NFIX from Human, Mouse. This NFIX antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310

NFIX Polyclonal Antibody
ABP59456-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310 Applications tips:
Description: A polyclonal antibody for detection of NFIX from Human, Mouse. This NFIX antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310

NFIX Polyclonal Antibody
A64710	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

NFIX Polyclonal Antibody
31707-100ul	SAB	100ul	EUR 252

NFIX Polyclonal Antibody
31707-50ul	SAB	50ul	EUR 187

NFIX Rabbit pAb
A9390-100ul	Abclonal	100 ul	EUR 308

NFIX Rabbit pAb
A9390-200ul	Abclonal	200 ul	EUR 459

NFIX Rabbit pAb
A9390-20ul	Abclonal	20 ul	EUR 183

NFIX Rabbit pAb
A9390-50ul	Abclonal	50 ul	EUR 223

NFIX Polyclonal Conjugated Antibody
C31707	SAB	100ul	EUR 397

Human Nuclear Factor I/X (NFIX) ELISA Kit
DLR-NFIX-Hu-48T	DL Develop	48T	EUR 517
Should the Human Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Human Nuclear Factor I/X (NFIX) ELISA Kit
DLR-NFIX-Hu-96T	DL Develop	96T	EUR 673
Should the Human Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Mouse Nuclear Factor I/X (NFIX) ELISA Kit
DLR-NFIX-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Mouse Nuclear Factor I/X (NFIX) ELISA Kit
DLR-NFIX-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Rat Nuclear Factor I/X (NFIX) ELISA Kit
DLR-NFIX-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Rat Nuclear Factor I/X (NFIX) ELISA Kit
DLR-NFIX-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids.

Human Nuclear Factor I/X (NFIX) ELISA Kit
RD-NFIX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Nuclear Factor I/X (NFIX) ELISA Kit
RD-NFIX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Nuclear Factor I/X (NFIX) ELISA Kit
RD-NFIX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Nuclear Factor I/X (NFIX) ELISA Kit
RD-NFIX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Nuclear Factor I/X (NFIX) ELISA Kit
RD-NFIX-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Nuclear Factor I/X (NFIX) ELISA Kit
RD-NFIX-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Nuclear Factor I/X (NFIX) ELISA Kit
RDR-NFIX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Nuclear Factor I/X (NFIX) ELISA Kit
RDR-NFIX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Nuclear Factor I/X (NFIX) ELISA Kit
RDR-NFIX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Nuclear Factor I/X (NFIX) ELISA Kit
RDR-NFIX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Nuclear Factor I/X (NFIX) ELISA Kit
RDR-NFIX-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Nuclear Factor I/X (NFIX) ELISA Kit
RDR-NFIX-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

NFIX Antibody
1-CSB-PA617941LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NFIX Polyclonal Antibody, HRP Conjugated
A64711	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

NFIX Polyclonal Antibody, FITC Conjugated
A64712	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

NFIX Polyclonal Antibody, Biotin Conjugated
A64713	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

NFIX-Specific Antibody
abx235701-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Anti-NFIX antibody
STJ113639	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene.

Anti-NFIX antibody
STJ191090	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NFIX

NFIX siRNA
20-abx925823	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NFIX siRNA
20-abx925824	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-NFIX
YF-PA13434	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to NFIX

anti- NFIX-Specific antibody
FNab05701	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 Immunogen: nuclear factor I/X(CCAAT-binding transcription factor) Uniprot ID: Q14938 Research Area: Neuroscience, Epigenetics
Description: Antibody raised against NFIX-Specific

NFIX Antibody, HRP conjugated
1-CSB-PA617941LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NFIX Antibody, FITC conjugated
1-CSB-PA617941LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NFIX Antibody, Biotin conjugated
1-CSB-PA617941LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-NFIX-Specific antibody
PAab05701	Lifescience Market	100 ug	EUR 386

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat)
4-PAF665Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NFIX (His13~Thr298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX)

NFIX cloning plasmid
CSB-CL617941HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1323 Sequence: atgctcccggcttgccgcctgcaggatgagttccacccgttcatcgaggcactgctgcctcacgtccgcgctttctcctacacctggttcaacctgcaggcgcggaagcgcaagtacttcaagaagcatgaaaagcggatgtcgaaggacgaggagcgggcggtgaaggacgagc Show more
Description: A cloning plasmid for the NFIX gene.

Anti-NFIX (3D2)
YF-MA14438	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to NFIX

NFIA / NFIB / NFIC / NFIX Antibody
20-abx328698	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

NFIA/NFIB/NFIC/NFIX Antibody
1-CSB-PA020079	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NFIA/NFIB/NFIC/NFIX. Recognizes NFIA/NFIB/NFIC/NFIX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), APC
4-PAF665Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NFIX (His13~Thr298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with APC.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), Biotinylated
4-PAF665Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NFIX (His13~Thr298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with Biotin.

Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), Cy3
4-PAF665Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NFIX (His13~Thr298) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with Cy3.

NFIX Rabbit Polyclonal Antibody