NFIX Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
NFIX Polyclonal Antibody |
ABP59456-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310
- Applications tips:
|
Description: A polyclonal antibody for detection of NFIX from Human, Mouse. This NFIX antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310 |
NFIX Polyclonal Antibody |
ABP59456-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310
- Applications tips:
|
Description: A polyclonal antibody for detection of NFIX from Human, Mouse. This NFIX antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310 |
NFIX Polyclonal Antibody |
ABP59456-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310
- Applications tips:
|
Description: A polyclonal antibody for detection of NFIX from Human, Mouse. This NFIX antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NFIX protein at amino acid sequence of 230-310 |
NFIX Polyclonal Antibody |
A64710 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
NFIX Polyclonal Antibody |
31707-100ul |
SAB |
100ul |
EUR 252 |
NFIX Polyclonal Antibody |
31707-50ul |
SAB |
50ul |
EUR 187 |
NFIX Rabbit pAb |
A9390-100ul |
Abclonal |
100 ul |
EUR 308 |
NFIX Rabbit pAb |
A9390-200ul |
Abclonal |
200 ul |
EUR 459 |
NFIX Rabbit pAb |
A9390-20ul |
Abclonal |
20 ul |
EUR 183 |
NFIX Rabbit pAb |
A9390-50ul |
Abclonal |
50 ul |
EUR 223 |
NFIX Polyclonal Conjugated Antibody |
C31707 |
SAB |
100ul |
EUR 397 |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
DLR-NFIX-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Nuclear Factor I/X (NFIX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nuclear Factor I/X (NFIX) in samples from tissue homogenates or other biological fluids. |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
RD-NFIX-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Nuclear Factor I/X (NFIX) ELISA Kit |
RDR-NFIX-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
NFIX Antibody |
1-CSB-PA617941LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NFIX Polyclonal Antibody, HRP Conjugated |
A64711 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
NFIX Polyclonal Antibody, FITC Conjugated |
A64712 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
NFIX Polyclonal Antibody, Biotin Conjugated |
A64713 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
NFIX-Specific Antibody |
abx235701-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Anti-NFIX antibody |
STJ113639 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. |
Anti-NFIX antibody |
STJ191090 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NFIX |
NFIX siRNA |
20-abx925823 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NFIX siRNA |
20-abx925824 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NFIX |
YF-PA13434 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NFIX |
anti- NFIX-Specific antibody |
FNab05701 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:1000
- Immunogen: nuclear factor I/X(CCAAT-binding transcription factor)
- Uniprot ID: Q14938
- Research Area: Neuroscience, Epigenetics
|
Description: Antibody raised against NFIX-Specific |
NFIX Antibody, HRP conjugated |
1-CSB-PA617941LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NFIX Antibody, FITC conjugated |
1-CSB-PA617941LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NFIX Antibody, Biotin conjugated |
1-CSB-PA617941LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NFIX. Recognizes NFIX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat) |
4-PAF665Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX) |
NFIX cloning plasmid |
CSB-CL617941HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1323
- Sequence: atgctcccggcttgccgcctgcaggatgagttccacccgttcatcgaggcactgctgcctcacgtccgcgctttctcctacacctggttcaacctgcaggcgcggaagcgcaagtacttcaagaagcatgaaaagcggatgtcgaaggacgaggagcgggcggtgaaggacgagc
- Show more
|
Description: A cloning plasmid for the NFIX gene. |
Anti-NFIX (3D2) |
YF-MA14438 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NFIX |
NFIA / NFIB / NFIC / NFIX Antibody |
20-abx328698 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NFIA/NFIB/NFIC/NFIX Antibody |
1-CSB-PA020079 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against NFIA/NFIB/NFIC/NFIX. Recognizes NFIA/NFIB/NFIC/NFIX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), APC |
4-PAF665Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with APC. |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), Biotinylated |
4-PAF665Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with Biotin. |
Nuclear Factor I/X (NFIX) Polyclonal Antibody (Rat), Cy3 |
4-PAF665Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NFIX (His13~Thr298)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Nuclear Factor I/X (NFIX). This antibody is labeled with Cy3. |
NFIX Rabbit Polyclonal Antibody