NGDN Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
NGDN Polyclonal Antibody |
ABP59460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320
- Applications tips:
|
Description: A polyclonal antibody for detection of NGDN from Human, Mouse. This NGDN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320 |
NGDN Polyclonal Antibody |
ABP59460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320
- Applications tips:
|
Description: A polyclonal antibody for detection of NGDN from Human, Mouse. This NGDN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320 |
NGDN Polyclonal Antibody |
ABP59460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320
- Applications tips:
|
Description: A polyclonal antibody for detection of NGDN from Human, Mouse. This NGDN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NGDN protein at amino acid sequence of 240-320 |
NGDN Polyclonal Antibody |
28607-100ul |
SAB |
100ul |
EUR 252 |
NGDN Polyclonal Antibody |
28607-50ul |
SAB |
50ul |
EUR 187 |
NGDN Polyclonal Antibody |
28614-100ul |
SAB |
100ul |
EUR 252 |
NGDN Polyclonal Antibody |
28614-50ul |
SAB |
50ul |
EUR 187 |
NGDN Rabbit pAb |
A14509-100ul |
Abclonal |
100 ul |
EUR 308 |
NGDN Rabbit pAb |
A14509-200ul |
Abclonal |
200 ul |
EUR 459 |
NGDN Rabbit pAb |
A14509-20ul |
Abclonal |
20 ul |
EUR 183 |
NGDN Rabbit pAb |
A14509-50ul |
Abclonal |
50 ul |
EUR 223 |
NGDN Rabbit pAb |
A14546-100ul |
Abclonal |
100 ul |
EUR 308 |
NGDN Rabbit pAb |
A14546-200ul |
Abclonal |
200 ul |
EUR 459 |
NGDN Rabbit pAb |
A14546-20ul |
Abclonal |
20 ul |
EUR 183 |
NGDN Rabbit pAb |
A14546-50ul |
Abclonal |
50 ul |
EUR 223 |
NGDN Polyclonal Conjugated Antibody |
C28607 |
SAB |
100ul |
EUR 397 |
NGDN Polyclonal Conjugated Antibody |
C28614 |
SAB |
100ul |
EUR 397 |
NGDN antibody |
70R-18869 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NGDN antibody |
NGDN Antibody |
1-CSB-PA015777GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NGDN. Recognizes NGDN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
anti- NGDN antibody |
FNab05719 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: neuroguidin, EIF4E binding protein
- Uniprot ID: Q8NEJ9
- Gene ID: 25983
- Research Area: Epigenetics
|
Description: Antibody raised against NGDN |
Neuroguidin (NGDN) Antibody |
abx028395-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neuroguidin (NGDN) Antibody |
abx028395-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neuroguidin (NGDN) Antibody |
abx235719-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-NGDN antibody |
STJ191068 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NGDN |
NGDN siRNA |
20-abx925858 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NGDN siRNA |
20-abx925859 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NGDN cloning plasmid |
CSB-CL822772HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 948
- Sequence: atggcggcgctgggggtgctggagtccgacctgccaagtgccgtgacacttctgaaaaatctccaggagcaagtgatggctgtaactgcacaagtgaaatcactgacacaaaaagttcaagctggtgcctatcctacagaaaagggtctcagcttcttggaagtgaaagaccagct
- Show more
|
Description: A cloning plasmid for the NGDN gene. |
NGDN Rabbit Polyclonal Antibody