NIPBL Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
NIPBL Polyclonal Antibody |
ABP59469-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NIPBL protein at amino acid sequence of 560-640
- Applications tips:
|
Description: A polyclonal antibody for detection of NIPBL from Human, Mouse. This NIPBL antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NIPBL protein at amino acid sequence of 560-640 |
NIPBL Polyclonal Antibody |
ES9928-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NIPBL from Human/Mouse. This antibody is tested and validated for IHC |
NIPBL Polyclonal Antibody |
ES9928-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NIPBL from Human/Mouse. This antibody is tested and validated for IHC |
NIPBL Polyclonal Conjugated Antibody |
C31986 |
SAB |
100ul |
EUR 397 |
NIPBL antibody |
70R-18882 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NIPBL antibody |
NIPBL antibody |
31986-100ul |
SAB |
100ul |
EUR 252 |
NIPBL antibody |
31986-50ul |
SAB |
50ul |
EUR 187 |
NIPBL Antibody |
1-CSB-PA750379LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200 |
NIPBL Antibody |
1-CSB-PA015817GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
NIPBL, Cohesin Loading Factor (NIPBL) Antibody |
abx235737-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
NIPBL, Cohesin Loading Factor (NIPBL) Antibody |
abx432139-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
NIPBL, Cohesin Loading Factor (NIPBL) Antibody |
20-abx302537 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NIPBL, Cohesin Loading Factor (NIPBL) Antibody (HRP) |
20-abx316309 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NIPBL, Cohesin Loading Factor (NIPBL) Antibody (FITC) |
20-abx316310 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NIPBL, Cohesin Loading Factor (NIPBL) Antibody (Biotin) |
20-abx316311 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
anti- NIPBL antibody |
FNab05737 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: Nipped-B homolog(Drosophila)
- Uniprot ID: Q6KC79
- Gene ID: 25836
- Research Area: Metabolism
|
Description: Antibody raised against NIPBL |
Anti-NIPBL antibody |
STJ191086 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NIPBL |
NIPBL siRNA |
20-abx925929 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NIPBL siRNA |
20-abx925930 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NIPBL Antibody, HRP conjugated |
1-CSB-PA750379LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NIPBL Antibody, FITC conjugated |
1-CSB-PA750379LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NIPBL Antibody, Biotin conjugated |
1-CSB-PA750379LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NIPBL. Recognizes NIPBL from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human NIPBL, Cohesin Loading Factor (NIPBL) ELISA Kit |
abx381806-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
NIPBL cloning plasmid |
CSB-CL750379HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 528
- Sequence: atgaaatgtttgccagaaaattcagctcctttaatcgaatttgcaaatgtgtcccagggtattttattacttctcatgttaaaacaacatttgaagaatctttgtggattttctgatagtaaaattcagaagtactctccatctgaatctgcaaaagtatatgataaagcgataaa
- Show more
|
Description: A cloning plasmid for the NIPBL gene. |
Mouse NIPBL shRNA Plasmid |
20-abx977367 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NIPBL shRNA Plasmid |
20-abx958532 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NIPBL ORF Vector (Human) (pORF) |
ORF007085 |
ABM |
1.0 ug DNA |
EUR 95 |
Nipbl ORF Vector (Mouse) (pORF) |
ORF051387 |
ABM |
1.0 ug DNA |
EUR 3033 |
Nipbl ORF Vector (Mouse) (pORF) |
ORF051388 |
ABM |
1.0 ug DNA |
EUR 2918 |
Nipbl sgRNA CRISPR Lentivector set (Mouse) |
K4529901 |
ABM |
3 x 1.0 ug |
EUR 339 |
NIPBL sgRNA CRISPR Lentivector set (Human) |
K1428601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nipbl sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4529902 |
ABM |
1.0 ug DNA |
EUR 154 |
Nipbl sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4529903 |
ABM |
1.0 ug DNA |
EUR 154 |
Nipbl sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4529904 |
ABM |
1.0 ug DNA |
EUR 154 |
NIPBL sgRNA CRISPR Lentivector (Human) (Target 1) |
K1428602 |
ABM |
1.0 ug DNA |
EUR 154 |
NIPBL sgRNA CRISPR Lentivector (Human) (Target 2) |
K1428603 |
ABM |
1.0 ug DNA |
EUR 154 |
NIPBL sgRNA CRISPR Lentivector (Human) (Target 3) |
K1428604 |
ABM |
1.0 ug DNA |
EUR 154 |
NIPBL Protein Vector (Mouse) (pPB-C-His) |
PV205546 |
ABM |
500 ng |
EUR 4514 |
NIPBL Protein Vector (Mouse) (pPB-N-His) |
PV205547 |
ABM |
500 ng |
EUR 4514 |
NIPBL Protein Vector (Mouse) (pPM-C-HA) |
PV205548 |
ABM |
500 ng |
EUR 4514 |
NIPBL Protein Vector (Mouse) (pPM-C-His) |
PV205549 |
ABM |
500 ng |
EUR 4514 |
NIPBL Protein Vector (Mouse) (pPB-C-His) |
PV205550 |
ABM |
500 ng |
EUR 4351 |
NIPBL Protein Vector (Mouse) (pPB-N-His) |
PV205551 |
ABM |
500 ng |
EUR 4351 |
NIPBL Protein Vector (Mouse) (pPM-C-HA) |
PV205552 |
ABM |
500 ng |
EUR 4351 |
NIPBL Protein Vector (Mouse) (pPM-C-His) |
PV205553 |
ABM |
500 ng |
EUR 4351 |
NIPBL Rabbit Polyclonal Antibody