NLGN3 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
NLGN3 Polyclonal Antibody |
ABP59479-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690
- Applications tips:
|
Description: A polyclonal antibody for detection of NLGN3 from Human, Mouse, Rat. This NLGN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690 |
NLGN3 Polyclonal Antibody |
ABP59479-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690
- Applications tips:
|
Description: A polyclonal antibody for detection of NLGN3 from Human, Mouse, Rat. This NLGN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690 |
NLGN3 Polyclonal Antibody |
ABP59479-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690
- Applications tips:
|
Description: A polyclonal antibody for detection of NLGN3 from Human, Mouse, Rat. This NLGN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLGN3 protein at amino acid sequence of 610-690 |
NLGN3 Rabbit pAb |
A10310-100ul |
Abclonal |
100 ul |
EUR 308 |
NLGN3 Rabbit pAb |
A10310-200ul |
Abclonal |
200 ul |
EUR 459 |
NLGN3 Rabbit pAb |
A10310-20ul |
Abclonal |
20 ul |
EUR 183 |
NLGN3 Rabbit pAb |
A10310-50ul |
Abclonal |
50 ul |
EUR 223 |
NLGN3 Antibody |
46087-100ul |
SAB |
100ul |
EUR 252 |
NLGN3 Antibody |
46087-50ul |
SAB |
50ul |
EUR 187 |
NLGN3 Antibody |
DF9692 |
Affbiotech |
200ul |
EUR 304 |
Description: NLGN3 Antibody detects endogenous levels of total NLGN3. |
NLGN3 Antibody |
1-CSB-PA873703LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500 |
Polyclonal Nlgn3 Antibody - N-terminal region |
AMM06712G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Nlgn3 - N-terminal region. This antibody is tested and proven to work in the following applications: |
NLGN3 Conjugated Antibody |
C46087 |
SAB |
100ul |
EUR 397 |
Anti-NLGN3 antibody |
STJ112348 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. Mutations in this gene may be associated with autism and Asperger syndrome. Multiple transcript variants encoding distinct isoforms have been identified for this gene. |
Anti-NLGN3 antibody |
STJ191071 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NLGN3 |
NLGN3 siRNA |
20-abx903573 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLGN3 siRNA |
20-abx925998 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLGN3 siRNA |
20-abx925999 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuroligin-3 (NLGN3) Antibody |
20-abx126255 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Neuroligin 3 (Nlgn3) Antibody |
20-abx121179 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Neuroligin-3 (NLGN3) Antibody |
20-abx217192 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuroligin-3 (NLGN3) Antibody |
20-abx333727 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuroligin 3 (Nlgn3) Antibody |
abx433027-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Neuroligin 3 (Nlgn3) Antibody |
abx445080-100ug |
Abbexa |
100 ug |
EUR 523 |
- Shipped within 5-12 working days.
|
NLGN3 Antibody, HRP conjugated |
1-CSB-PA873703LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NLGN3 Antibody, FITC conjugated |
1-CSB-PA873703LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NLGN3 Antibody, Biotin conjugated |
1-CSB-PA873703LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NLGN3. Recognizes NLGN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NLGN3 cloning plasmid |
CSB-CL873703HU-10ug |
Cusabio |
10ug |
EUR 805 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2487
- Sequence: atgtggctgcggcttggcccgccctcgctgtccctgagccccaagcccacggttggcaggagcctgtgcctcaccctgtggttcctcagtttggcgctgagggccagtacccaggccccagcacccacagtcaacactcactttgggaagctaaggggtgcccgagtaccactgc
- Show more
|
Description: A cloning plasmid for the NLGN3 gene. |
NLGN3 Blocking Peptide |
DF9692-BP |
Affbiotech |
1mg |
EUR 195 |
Neuroligin-3 (NLGN3) Antibody (HRP) |
20-abx336763 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuroligin-3 (NLGN3) Antibody (FITC) |
20-abx336764 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuroligin-3 (NLGN3) Antibody (Biotin) |
20-abx336765 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
NLGN3 Rabbit Polyclonal Antibody