NLK Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
NLK Polyclonal Antibody |
ABP59480-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310
- Applications tips:
|
Description: A polyclonal antibody for detection of NLK from Human, Mouse, Rat. This NLK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310 |
NLK Polyclonal Antibody |
ABP59480-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310
- Applications tips:
|
Description: A polyclonal antibody for detection of NLK from Human, Mouse, Rat. This NLK antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NLK protein at amino acid sequence of 230-310 |
NLK Rabbit pAb |
A3190-100ul |
Abclonal |
100 ul |
EUR 308 |
NLK Rabbit pAb |
A3190-200ul |
Abclonal |
200 ul |
EUR 459 |
NLK Rabbit pAb |
A3190-20ul |
Abclonal |
20 ul |
EUR 183 |
NLK Rabbit pAb |
A3190-50ul |
Abclonal |
50 ul |
EUR 223 |
NLK antibody |
70R-9450 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal NLK antibody |
NLK antibody |
38629-100ul |
SAB |
100ul |
EUR 252 |
NLK antibody |
23128-100ul |
SAB |
100ul |
EUR 390 |
NLK antibody |
70R-13123 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal NLK antibody |
NLK Antibody |
DF7243 |
Affbiotech |
200ul |
EUR 304 |
Description: NLK Antibody detects endogenous levels of total NLK. |
NLK Antibody |
DF7575 |
Affbiotech |
200ul |
EUR 304 |
Description: NLK Antibody detects endogenous levels of total NLK. |
NLK Antibody |
1-CSB-PA890657ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NLK. Recognizes NLK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NLK Antibody |
1-CSB-PA890657ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NLK. Recognizes NLK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
Polyclonal NLK Antibody (C-term) |
APR17584G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NLK (C-term). This antibody is tested and proven to work in the following applications: |
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
20-abx125032 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
20-abx002290 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
abx034924-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
abx034924-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
abx033464-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
abx033464-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
20-abx320761 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase NLK (NLK) Antibody |
20-abx321819 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLK Conjugated Antibody |
C38629 |
SAB |
100ul |
EUR 397 |
Monoclonal NLK Antibody |
APR17825G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human NLK. The antibodies are raised in Mouse. This antibody is applicable in WB |
NLK-T286 Antibody |
abx033465-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
NLK-T286 Antibody |
abx033465-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Anti-NLK antibody |
STJ191357 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NLK |
NLK siRNA |
20-abx903574 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLK siRNA |
20-abx926002 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NLK siRNA |
20-abx926003 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NLK |
YF-PA19168 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NLK |
anti-NLK |
YF-PA26210 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to NLK |
NLK Blocking Peptide |
33R-8051 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NLK antibody, catalog no. 70R-9450 |
NLK Blocking Peptide |
DF7243-BP |
Affbiotech |
1mg |
EUR 195 |
NLK Blocking Peptide |
DF7575-BP |
Affbiotech |
1mg |
EUR 195 |
NLK cloning plasmid |
CSB-CL890657HU-10ug |
Cusabio |
10ug |
EUR 544 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1548
- Sequence: atggcggcttacaatggcggtacatctgcagcagcaacaggtcaccaccaccaccatcaccaccaccttccacacctccctcctcctcacctgcaccaccaccaccaccctcaacaccatcttcatccggggtcggctgccgctgtacaccctgtacagcagcacacctcttcgg
- Show more
|
Description: A cloning plasmid for the NLK gene. |
Anti-NLK (1C1) |
YF-MA18555 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NLK |
Anti-NLK (2B11) |
YF-MA18556 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to NLK |
Monoclonal NLK Antibody, Clone: 1146CT24.2.1 |
APR17583G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human NLK. The antibodies are raised in Mouse and are from clone 1146CT24.2.1. This antibody is applicable in WB, E |
Mouse Serine/threonine- protein kinase NLK, Nlk ELISA KIT |
ELI-15096m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Serine/threonine- protein kinase NLK, NLK ELISA KIT |
ELI-44037h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Serine/threonine- protein kinase NLK, NLK ELISA KIT |
ELI-38287b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Serine/threonine-protein kinase NLK (NLK) ELISA Kit |
abx385203-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Serine/threonine-protein kinase NLK (NLK) ELISA Kit |
abx390000-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Serine/threonine-protein kinase NLK (NLK) ELISA Kit |
abx391676-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Nlk ELISA Kit| Mouse Serine/threonine-protein kinase NLK ELISA |
EF015639 |
Lifescience Market |
96 Tests |
EUR 689 |
NLK ELISA Kit| Bovine Serine/threonine-protein kinase NLK ELISA |
EF011651 |
Lifescience Market |
96 Tests |
EUR 689 |
Human NLK shRNA Plasmid |
20-abx959907 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NLK shRNA Plasmid |
20-abx971760 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NLK shRNA Plasmid |
20-abx990833 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Nlk ELISA Kit| Rat Serine/threonine-protein kinase NLK ELISA Ki |
EF019036 |
Lifescience Market |
96 Tests |
EUR 689 |
NLK ORF Vector (Human) (pORF) |
ORF007104 |
ABM |
1.0 ug DNA |
EUR 95 |
Nlk ORF Vector (Rat) (pORF) |
ORF071352 |
ABM |
1.0 ug DNA |
EUR 506 |
Nlk ORF Vector (Mouse) (pORF) |
ORF051433 |
ABM |
1.0 ug DNA |
EUR 506 |
NLK sgRNA CRISPR Lentivector set (Human) |
K1432801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nlk sgRNA CRISPR Lentivector set (Mouse) |
K4852401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nlk sgRNA CRISPR Lentivector set (Rat) |
K6643801 |
ABM |
3 x 1.0 ug |
EUR 339 |
NLK sgRNA CRISPR Lentivector (Human) (Target 1) |
K1432802 |
ABM |
1.0 ug DNA |
EUR 154 |
NLK sgRNA CRISPR Lentivector (Human) (Target 2) |
K1432803 |
ABM |
1.0 ug DNA |
EUR 154 |
NLK sgRNA CRISPR Lentivector (Human) (Target 3) |
K1432804 |
ABM |
1.0 ug DNA |
EUR 154 |
Nlk sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4852402 |
ABM |
1.0 ug DNA |
EUR 154 |
Nlk sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4852403 |
ABM |
1.0 ug DNA |
EUR 154 |
Nlk sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4852404 |
ABM |
1.0 ug DNA |
EUR 154 |
Nlk sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6643802 |
ABM |
1.0 ug DNA |
EUR 154 |
Nlk sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6643803 |
ABM |
1.0 ug DNA |
EUR 154 |
Nlk sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6643804 |
ABM |
1.0 ug DNA |
EUR 154 |
NLK Protein Vector (Rat) (pPB-C-His) |
PV285406 |
ABM |
500 ng |
EUR 603 |
NLK Protein Vector (Rat) (pPB-N-His) |
PV285407 |
ABM |
500 ng |
EUR 603 |
NLK Protein Vector (Rat) (pPM-C-HA) |
PV285408 |
ABM |
500 ng |
EUR 603 |
NLK Protein Vector (Rat) (pPM-C-His) |
PV285409 |
ABM |
500 ng |
EUR 603 |
NLK Protein Vector (Human) (pPB-C-His) |
PV028413 |
ABM |
500 ng |
EUR 329 |
NLK Protein Vector (Human) (pPB-N-His) |
PV028414 |
ABM |
500 ng |
EUR 329 |
NLK Protein Vector (Human) (pPM-C-HA) |
PV028415 |
ABM |
500 ng |
EUR 329 |
NLK Protein Vector (Human) (pPM-C-His) |
PV028416 |
ABM |
500 ng |
EUR 329 |
NLK Protein Vector (Mouse) (pPB-C-His) |
PV205730 |
ABM |
500 ng |
EUR 603 |
NLK Protein Vector (Mouse) (pPB-N-His) |
PV205731 |
ABM |
500 ng |
EUR 603 |
NLK Protein Vector (Mouse) (pPM-C-HA) |
PV205732 |
ABM |
500 ng |
EUR 603 |
NLK Protein Vector (Mouse) (pPM-C-His) |
PV205733 |
ABM |
500 ng |
EUR 603 |
NLK Rabbit Polyclonal Antibody