NOL7 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NOL7 Polyclonal Antibody
ES9957-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NOL7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOL7 Polyclonal Antibody
ES9957-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NOL7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOL7 Antibody
46110-100ul	SAB	100ul	EUR 252

NOL7 Antibody
46110-50ul	SAB	50ul	EUR 187

NOL7 Antibody
DF9720	Affbiotech	200ul	EUR 304
Description: NOL7 Antibody detects endogenous levels of total NOL7.

NOL7 Antibody
ABD9720	Lifescience Market	100 ug	EUR 438

NOL7 Conjugated Antibody
C46110	SAB	100ul	EUR 397

Anti-NOL7 antibody
STJ191115	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NOL7

NOL7 siRNA
20-abx926128	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOL7 siRNA
20-abx926129	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-NOL7
YF-PA19034	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to NOL7

NOL7 cloning plasmid
CSB-CL891973HU-10ug	Cusabio	10ug	EUR 327
Formulation: 10 μg plasmid + 200μl Glycerol Length: 774 Sequence: atggtgcagctccgaccgcgagcgtctcgcgccccggcgtcggcggaggcgatggtggacgagggccagctggcctcggaggaggaggaggcggagcacgggctgttgctcgggcagcccagcagcggcgcggccgccgagcccctggaggaagacgaggaaggggacgatgagtt Show more
Description: A cloning plasmid for the NOL7 gene.

NOL7 Blocking Peptide
DF9720-BP	Affbiotech	1mg	EUR 195

Nucleolar Protein 7 (NOL7) Antibody
20-abx217284	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Mouse NOL7 shRNA Plasmid
20-abx977122	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NOL7 shRNA Plasmid
20-abx959749	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NOL7 Recombinant Protein (Human)
RP021442	ABM	100 ug	Ask for price

NOL7 Recombinant Protein (Mouse)
RP154526	ABM	100 ug	Ask for price

NOL7 ORF Vector (Human) (pORF)
ORF007148	ABM	1.0 ug DNA	EUR 95

Nol7 ORF Vector (Mouse) (pORF)
ORF051510	ABM	1.0 ug DNA	EUR 506

Nol7 sgRNA CRISPR Lentivector set (Mouse)
K3535801	ABM	3 x 1.0 ug	EUR 339

NOL7 sgRNA CRISPR Lentivector set (Human)
K1439201	ABM	3 x 1.0 ug	EUR 339

Human Nucleolar protein 7, NOL7 ELISA KIT
ELI-21223h	Lifescience Market	96 Tests	EUR 824

Mouse Nucleolar protein 7, Nol7 ELISA KIT
ELI-35310m	Lifescience Market	96 Tests	EUR 865

Nol7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3535802	ABM	1.0 ug DNA	EUR 154

Nol7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3535803	ABM	1.0 ug DNA	EUR 154

Nol7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3535804	ABM	1.0 ug DNA	EUR 154

NOL7 sgRNA CRISPR Lentivector (Human) (Target 1)
K1439202	ABM	1.0 ug DNA	EUR 154

NOL7 sgRNA CRISPR Lentivector (Human) (Target 2)
K1439203	ABM	1.0 ug DNA	EUR 154

NOL7 sgRNA CRISPR Lentivector (Human) (Target 3)
K1439204	ABM	1.0 ug DNA	EUR 154

NOL7 Protein Vector (Mouse) (pPB-C-His)
PV206038	ABM	500 ng	EUR 603

NOL7 Protein Vector (Mouse) (pPB-N-His)
PV206039	ABM	500 ng	EUR 603

NOL7 Protein Vector (Mouse) (pPM-C-HA)
PV206040	ABM	500 ng	EUR 603

NOL7 Protein Vector (Mouse) (pPM-C-His)
PV206041	ABM	500 ng	EUR 603

NOL7 Protein Vector (Human) (pPB-C-His)
PV028589	ABM	500 ng	EUR 329

NOL7 Protein Vector (Human) (pPB-N-His)
PV028590	ABM	500 ng	EUR 329

NOL7 Protein Vector (Human) (pPM-C-HA)
PV028591	ABM	500 ng	EUR 329

NOL7 Protein Vector (Human) (pPM-C-His)
PV028592	ABM	500 ng	EUR 329

Human Nucleolar Protein 7(NOL7)ELISA Kit
QY-E03188	Qayee Biotechnology	96T	EUR 394

Nol7 3'UTR Luciferase Stable Cell Line
TU114200	ABM	1.0 ml	Ask for price

Nol7 3'UTR GFP Stable Cell Line
TU164200	ABM	1.0 ml	Ask for price

NOL7 3'UTR GFP Stable Cell Line
TU065807	ABM	1.0 ml	EUR 1394

NOL7 3'UTR Luciferase Stable Cell Line
TU015807	ABM	1.0 ml	EUR 1394

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NOL7 Rabbit Polyclonal Antibody