NOL7 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
NOL7 Polyclonal Antibody |
ES9957-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NOL7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NOL7 Polyclonal Antibody |
ES9957-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NOL7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NOL7 Antibody |
46110-100ul |
SAB |
100ul |
EUR 252 |
NOL7 Antibody |
46110-50ul |
SAB |
50ul |
EUR 187 |
NOL7 Antibody |
DF9720 |
Affbiotech |
200ul |
EUR 304 |
Description: NOL7 Antibody detects endogenous levels of total NOL7. |
NOL7 Conjugated Antibody |
C46110 |
SAB |
100ul |
EUR 397 |
Anti-NOL7 antibody |
STJ191115 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NOL7 |
NOL7 siRNA |
20-abx926128 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOL7 siRNA |
20-abx926129 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NOL7 |
YF-PA19034 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NOL7 |
NOL7 cloning plasmid |
CSB-CL891973HU-10ug |
Cusabio |
10ug |
EUR 327 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 774
- Sequence: atggtgcagctccgaccgcgagcgtctcgcgccccggcgtcggcggaggcgatggtggacgagggccagctggcctcggaggaggaggaggcggagcacgggctgttgctcgggcagcccagcagcggcgcggccgccgagcccctggaggaagacgaggaaggggacgatgagtt
- Show more
|
Description: A cloning plasmid for the NOL7 gene. |
NOL7 Blocking Peptide |
DF9720-BP |
Affbiotech |
1mg |
EUR 195 |
Nucleolar Protein 7 (NOL7) Antibody |
20-abx217284 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse NOL7 shRNA Plasmid |
20-abx977122 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NOL7 shRNA Plasmid |
20-abx959749 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NOL7 Recombinant Protein (Human) |
RP021442 |
ABM |
100 ug |
Ask for price |
NOL7 Recombinant Protein (Mouse) |
RP154526 |
ABM |
100 ug |
Ask for price |
NOL7 ORF Vector (Human) (pORF) |
ORF007148 |
ABM |
1.0 ug DNA |
EUR 95 |
Nol7 ORF Vector (Mouse) (pORF) |
ORF051510 |
ABM |
1.0 ug DNA |
EUR 506 |
Nol7 sgRNA CRISPR Lentivector set (Mouse) |
K3535801 |
ABM |
3 x 1.0 ug |
EUR 339 |
NOL7 sgRNA CRISPR Lentivector set (Human) |
K1439201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nol7 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3535802 |
ABM |
1.0 ug DNA |
EUR 154 |
Nol7 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3535803 |
ABM |
1.0 ug DNA |
EUR 154 |
Nol7 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3535804 |
ABM |
1.0 ug DNA |
EUR 154 |
NOL7 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1439202 |
ABM |
1.0 ug DNA |
EUR 154 |
NOL7 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1439203 |
ABM |
1.0 ug DNA |
EUR 154 |
NOL7 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1439204 |
ABM |
1.0 ug DNA |
EUR 154 |
NOL7 Protein Vector (Mouse) (pPB-C-His) |
PV206038 |
ABM |
500 ng |
EUR 603 |
NOL7 Protein Vector (Mouse) (pPB-N-His) |
PV206039 |
ABM |
500 ng |
EUR 603 |
NOL7 Protein Vector (Mouse) (pPM-C-HA) |
PV206040 |
ABM |
500 ng |
EUR 603 |
NOL7 Protein Vector (Mouse) (pPM-C-His) |
PV206041 |
ABM |
500 ng |
EUR 603 |
NOL7 Protein Vector (Human) (pPB-C-His) |
PV028589 |
ABM |
500 ng |
EUR 329 |
NOL7 Protein Vector (Human) (pPB-N-His) |
PV028590 |
ABM |
500 ng |
EUR 329 |
NOL7 Protein Vector (Human) (pPM-C-HA) |
PV028591 |
ABM |
500 ng |
EUR 329 |
NOL7 Protein Vector (Human) (pPM-C-His) |
PV028592 |
ABM |
500 ng |
EUR 329 |
Nol7 3'UTR Luciferase Stable Cell Line |
TU114200 |
ABM |
1.0 ml |
Ask for price |
Nol7 3'UTR GFP Stable Cell Line |
TU164200 |
ABM |
1.0 ml |
Ask for price |
NOL7 3'UTR GFP Stable Cell Line |
TU065807 |
ABM |
1.0 ml |
EUR 1394 |
NOL7 3'UTR Luciferase Stable Cell Line |
TU015807 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NOL7 Rabbit Polyclonal Antibody