NOL9 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NOL9 Polyclonal Antibody
ABP59495-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NOL9 protein at amino acid sequence of 640-720 Applications tips:
Description: A polyclonal antibody for detection of NOL9 from Human, Mouse. This NOL9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOL9 protein at amino acid sequence of 640-720

NOL9 Rabbit pAb
A9160-100ul	Abclonal	100 ul	EUR 308

NOL9 Rabbit pAb
A9160-200ul	Abclonal	200 ul	EUR 459

NOL9 Rabbit pAb
A9160-20ul	Abclonal	20 ul	Ask for price

NOL9 Rabbit pAb
A9160-50ul	Abclonal	50 ul	Ask for price

NOL9 Antibody
ABD9721	Lifescience Market	100 ug	EUR 438

NOL9 Antibody
36222-100ul	SAB	100ul	EUR 252

NOL9 Antibody
DF9721	Affbiotech	200ul	EUR 304
Description: NOL9 Antibody detects endogenous levels of total NOL9.

NOL9 Antibody
1-CSB-PA150875	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NOL9. Recognizes NOL9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

Polyclonal NOL9 Antibody (C-term)
APR06213G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOL9 (C-term). This antibody is tested and proven to work in the following applications:

NOL9 Conjugated Antibody
C36222	SAB	100ul	EUR 397

anti- NOL9 antibody
FNab05789	FN Test	100µg	EUR 585
Immunogen: nucleolar protein 9 Uniprot ID: Q5SY16 Gene ID: 79707 Research Area: Metabolism
Description: Antibody raised against NOL9

Anti-NOL9 antibody
PAab05789	Lifescience Market	100 ug	EUR 412

Anti-NOL9 antibody
STJ111591	St John's Laboratory	100 µl	EUR 277

Anti-NOL9 antibody
STJ191116	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NOL9

NOL9 siRNA
20-abx926132	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOL9 siRNA
20-abx926133	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOL9 Blocking Peptide
DF9721-BP	Affbiotech	1mg	EUR 195

NOL9 cloning plasmid
CSB-CL725557HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2109 Sequence: ATGGCGGACTCGGGACTGCTGCTAAAGTGGGGTTCCTGCCGTTCCACTTGGCTGCGGGTCCGCAAGGCCCGGCCCCAGCTCATCCTCAGCCGCCGGCCCCGCCGCCGGCTCGGGAGCCTGCGCTGGTGCGGTCGGCGGCGCCTACGGCGGCGGTTACTGCAAGCCCAGGCGGCCG Show more
Description: A cloning plasmid for the NOL9 gene.

Nucleolar Protein 9 (NOL9) Antibody
20-abx124786	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody
abx122121-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody
abx034569-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody
abx034569-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Nucleolar Protein 9 (NOL9) Antibody
abx235789-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Nucleolar Protein 9 (NOL9) Antibody
20-abx211330	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Human Polynucleotide 5'- hydroxyl- kinase NOL9, NOL9 ELISA KIT
ELI-15001h	Lifescience Market	96 Tests	EUR 824

Mouse Polynucleotide 5'- hydroxyl- kinase NOL9, Nol9 ELISA KIT
ELI-44124m	Lifescience Market	96 Tests	EUR 865

Bovine Polynucleotide 5'- hydroxyl- kinase NOL9, NOL9 ELISA KIT
ELI-44672b	Lifescience Market	96 Tests	EUR 928

Mouse NOL9 shRNA Plasmid
20-abx978066	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NOL9 ELISA KIT|Human
EF001279	Lifescience Market	96 Tests	EUR 689

Human NOL9 shRNA Plasmid
20-abx962501	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

NOL9 Recombinant Protein (Human)
RP041680	ABM	100 ug	Ask for price

NOL9 Recombinant Protein (Mouse)
RP154532	ABM	100 ug	Ask for price

NOL9 Recombinant Protein (Mouse)
RP154535	ABM	100 ug	Ask for price

NOL9 ORF Vector (Human) (pORF)
ORF013894	ABM	1.0 ug DNA	EUR 354

Nol9 ORF Vector (Mouse) (pORF)
ORF051512	ABM	1.0 ug DNA	EUR 506

Nol9 ORF Vector (Mouse) (pORF)
ORF051513	ABM	1.0 ug DNA	EUR 506

NOL9 sgRNA CRISPR Lentivector set (Human)
K1439401	ABM	3 x 1.0 ug	EUR 339

Nol9 sgRNA CRISPR Lentivector set (Mouse)
K4769401	ABM	3 x 1.0 ug	EUR 339

Human Nucleolar Protein 9 (NOL9) ELISA Kit
abx381843-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

NOL9 sgRNA CRISPR Lentivector (Human) (Target 1)
K1439402	ABM	1.0 ug DNA	EUR 154

NOL9 sgRNA CRISPR Lentivector (Human) (Target 2)
K1439403	ABM	1.0 ug DNA	EUR 154

NOL9 sgRNA CRISPR Lentivector (Human) (Target 3)
K1439404	ABM	1.0 ug DNA	EUR 154

Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4769402	ABM	1.0 ug DNA	EUR 154

Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4769403	ABM	1.0 ug DNA	EUR 154

Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4769404	ABM	1.0 ug DNA	EUR 154

NOL9 Protein Vector (Human) (pPB-C-His)
PV055573	ABM	500 ng	EUR 481

NOL9 Protein Vector (Human) (pPB-N-His)
PV055574	ABM	500 ng	EUR 481

NOL9 Protein Vector (Human) (pPM-C-HA)
PV055575	ABM	500 ng	EUR 481

NOL9 Protein Vector (Human) (pPM-C-His)
PV055576	ABM	500 ng	EUR 481

Human Nucleolar Protein 9(NOL9)ELISA Kit
QY-E03186	Qayee Biotechnology	96T	EUR 361

NOL9 Protein Vector (Mouse) (pPB-C-His)
PV206046	ABM	500 ng	EUR 1065

NOL9 Protein Vector (Mouse) (pPB-N-His)
PV206047	ABM	500 ng	EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-HA)
PV206048	ABM	500 ng	EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-His)
PV206049	ABM	500 ng	EUR 1065

NOL9 Protein Vector (Mouse) (pPB-C-His)
PV206050	ABM	500 ng	EUR 1065

NOL9 Protein Vector (Mouse) (pPB-N-His)
PV206051	ABM	500 ng	EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-HA)
PV206052	ABM	500 ng	EUR 1065

NOL9 Protein Vector (Mouse) (pPM-C-His)
PV206053	ABM	500 ng	EUR 1065

NOL9 3'UTR Luciferase Stable Cell Line
TU015809	ABM	1.0 ml	EUR 2333

NOL9 3'UTR GFP Stable Cell Line
TU065809	ABM	1.0 ml	EUR 2333

Nol9 3'UTR GFP Stable Cell Line
TU264075	ABM	1.0 ml	Ask for price

Nol9 3'UTR Luciferase Stable Cell Line
TU214075	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NOL9 Rabbit Polyclonal Antibody