NOL9 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
NOL9 Polyclonal Antibody |
ABP59495-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NOL9 protein at amino acid sequence of 640-720
- Applications tips:
|
Description: A polyclonal antibody for detection of NOL9 from Human, Mouse. This NOL9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOL9 protein at amino acid sequence of 640-720 |
NOL9 Rabbit pAb |
A9160-100ul |
Abclonal |
100 ul |
EUR 308 |
NOL9 Rabbit pAb |
A9160-200ul |
Abclonal |
200 ul |
EUR 459 |
NOL9 Rabbit pAb |
A9160-20ul |
Abclonal |
20 ul |
Ask for price |
NOL9 Rabbit pAb |
A9160-50ul |
Abclonal |
50 ul |
Ask for price |
NOL9 Antibody |
36222-100ul |
SAB |
100ul |
EUR 252 |
NOL9 Antibody |
DF9721 |
Affbiotech |
200ul |
EUR 304 |
Description: NOL9 Antibody detects endogenous levels of total NOL9. |
NOL9 Antibody |
1-CSB-PA150875 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NOL9. Recognizes NOL9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
Polyclonal NOL9 Antibody (C-term) |
APR06213G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NOL9 (C-term). This antibody is tested and proven to work in the following applications: |
NOL9 Conjugated Antibody |
C36222 |
SAB |
100ul |
EUR 397 |
anti- NOL9 antibody |
FNab05789 |
FN Test |
100µg |
EUR 585 |
- Immunogen: nucleolar protein 9
- Uniprot ID: Q5SY16
- Gene ID: 79707
- Research Area: Metabolism
|
Description: Antibody raised against NOL9 |
Anti-NOL9 antibody |
STJ191116 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NOL9 |
NOL9 siRNA |
20-abx926132 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOL9 siRNA |
20-abx926133 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOL9 Blocking Peptide |
DF9721-BP |
Affbiotech |
1mg |
EUR 195 |
NOL9 cloning plasmid |
CSB-CL725557HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2109
- Sequence: ATGGCGGACTCGGGACTGCTGCTAAAGTGGGGTTCCTGCCGTTCCACTTGGCTGCGGGTCCGCAAGGCCCGGCCCCAGCTCATCCTCAGCCGCCGGCCCCGCCGCCGGCTCGGGAGCCTGCGCTGGTGCGGTCGGCGGCGCCTACGGCGGCGGTTACTGCAAGCCCAGGCGGCCG
- Show more
|
Description: A cloning plasmid for the NOL9 gene. |
Nucleolar Protein 9 (NOL9) Antibody |
20-abx124786 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nucleolar Protein 9 (NOL9) Antibody |
abx122121-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nucleolar Protein 9 (NOL9) Antibody |
abx034569-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Nucleolar Protein 9 (NOL9) Antibody |
abx034569-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Nucleolar Protein 9 (NOL9) Antibody |
abx235789-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Nucleolar Protein 9 (NOL9) Antibody |
20-abx211330 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Polynucleotide 5'- hydroxyl- kinase NOL9, NOL9 ELISA KIT |
ELI-15001h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Polynucleotide 5'- hydroxyl- kinase NOL9, Nol9 ELISA KIT |
ELI-44124m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Polynucleotide 5'- hydroxyl- kinase NOL9, NOL9 ELISA KIT |
ELI-44672b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse NOL9 shRNA Plasmid |
20-abx978066 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NOL9 shRNA Plasmid |
20-abx962501 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NOL9 Recombinant Protein (Human) |
RP041680 |
ABM |
100 ug |
Ask for price |
NOL9 Recombinant Protein (Mouse) |
RP154532 |
ABM |
100 ug |
Ask for price |
NOL9 Recombinant Protein (Mouse) |
RP154535 |
ABM |
100 ug |
Ask for price |
NOL9 ORF Vector (Human) (pORF) |
ORF013894 |
ABM |
1.0 ug DNA |
EUR 354 |
Nol9 ORF Vector (Mouse) (pORF) |
ORF051512 |
ABM |
1.0 ug DNA |
EUR 506 |
Nol9 ORF Vector (Mouse) (pORF) |
ORF051513 |
ABM |
1.0 ug DNA |
EUR 506 |
NOL9 sgRNA CRISPR Lentivector set (Human) |
K1439401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nol9 sgRNA CRISPR Lentivector set (Mouse) |
K4769401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human Nucleolar Protein 9 (NOL9) ELISA Kit |
abx381843-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
NOL9 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1439402 |
ABM |
1.0 ug DNA |
EUR 154 |
NOL9 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1439403 |
ABM |
1.0 ug DNA |
EUR 154 |
NOL9 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1439404 |
ABM |
1.0 ug DNA |
EUR 154 |
Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4769402 |
ABM |
1.0 ug DNA |
EUR 154 |
Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4769403 |
ABM |
1.0 ug DNA |
EUR 154 |
Nol9 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4769404 |
ABM |
1.0 ug DNA |
EUR 154 |
NOL9 Protein Vector (Human) (pPB-C-His) |
PV055573 |
ABM |
500 ng |
EUR 481 |
NOL9 Protein Vector (Human) (pPB-N-His) |
PV055574 |
ABM |
500 ng |
EUR 481 |
NOL9 Protein Vector (Human) (pPM-C-HA) |
PV055575 |
ABM |
500 ng |
EUR 481 |
NOL9 Protein Vector (Human) (pPM-C-His) |
PV055576 |
ABM |
500 ng |
EUR 481 |
NOL9 Protein Vector (Mouse) (pPB-C-His) |
PV206046 |
ABM |
500 ng |
EUR 1065 |
NOL9 Protein Vector (Mouse) (pPB-N-His) |
PV206047 |
ABM |
500 ng |
EUR 1065 |
NOL9 Protein Vector (Mouse) (pPM-C-HA) |
PV206048 |
ABM |
500 ng |
EUR 1065 |
NOL9 Protein Vector (Mouse) (pPM-C-His) |
PV206049 |
ABM |
500 ng |
EUR 1065 |
NOL9 Protein Vector (Mouse) (pPB-C-His) |
PV206050 |
ABM |
500 ng |
EUR 1065 |
NOL9 Protein Vector (Mouse) (pPB-N-His) |
PV206051 |
ABM |
500 ng |
EUR 1065 |
NOL9 Protein Vector (Mouse) (pPM-C-HA) |
PV206052 |
ABM |
500 ng |
EUR 1065 |
NOL9 Protein Vector (Mouse) (pPM-C-His) |
PV206053 |
ABM |
500 ng |
EUR 1065 |
NOL9 3'UTR Luciferase Stable Cell Line |
TU015809 |
ABM |
1.0 ml |
EUR 2333 |
NOL9 3'UTR GFP Stable Cell Line |
TU065809 |
ABM |
1.0 ml |
EUR 2333 |
Nol9 3'UTR GFP Stable Cell Line |
TU264075 |
ABM |
1.0 ml |
Ask for price |
Nol9 3'UTR Luciferase Stable Cell Line |
TU214075 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NOL9 Rabbit Polyclonal Antibody