NOP14 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NOP14 Polyclonal Antibody
ES9955-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NOP14 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

NOP14 Polyclonal Antibody
ABP59496-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860 Applications tips:
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860

NOP14 Polyclonal Antibody
ABP59496-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860 Applications tips:
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860

NOP14 Polyclonal Antibody
ABP59496-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860 Applications tips:
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860

NOP14 Polyclonal Antibody
27397-100ul	SAB	100ul	EUR 252

NOP14 Polyclonal Antibody
27397-50ul	SAB	50ul	EUR 187

NOP14 Rabbit pAb
A10361-100ul	Abclonal	100 ul	EUR 308

NOP14 Rabbit pAb
A10361-200ul	Abclonal	200 ul	EUR 459

NOP14 Rabbit pAb
A10361-20ul	Abclonal	20 ul	EUR 183

NOP14 Rabbit pAb
A10361-50ul	Abclonal	50 ul	EUR 223

NOP14 Polyclonal Conjugated Antibody
C27397	SAB	100ul	EUR 397

NOP14 Antibody
20-abx126263	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Anti-NOP14 antibody
STJ112398	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that plays a role in pre-18s rRNA processing and small ribosomal subunit assembly. The encoded protein may be involved in the regulation of pancreatic cancer cell proliferation and migration. Alternative splicing results in multiple transcript variants.

Anti-NOP14 antibody
STJ191113	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NOP14

NOP14 siRNA
20-abx926146	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOP14 siRNA
20-abx926147	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NOP14 cloning plasmid
CSB-CL015936HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2421 Sequence: atggcgaaggcgaagaaggtcggggcgcgaaggaaggcctccggggcgccggcgggagcgcgagggggcccggcgaaggccaactccaatccgttcgaggtgaaagttaacaggcagaagttccagatcctgggccggaagacgcgccacgacgtgggactgcccggggtgtctc Show more
Description: A cloning plasmid for the NOP14 gene.

pDONR223-NOP14 Plasmid
PVTB00924	Lifescience Market	2 ug	EUR 356

Mouse NOP14 shRNA Plasmid
20-abx978393	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NOP14 shRNA Plasmid
20-abx955650	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCD513B-1-NOP14 Plasmid
PVTB00924-4a	Lifescience Market	2 ug	EUR 356

NOP14 ORF Vector (Human) (pORF)
ORF007154	ABM	1.0 ug DNA	EUR 95

Nop14 ORF Vector (Rat) (pORF)
ORF071407	ABM	1.0 ug DNA	EUR 506

Nop14 ORF Vector (Mouse) (pORF)
ORF051523	ABM	1.0 ug DNA	EUR 506

NOP14 sgRNA CRISPR Lentivector set (Human)
K1440601	ABM	3 x 1.0 ug	EUR 339

Nop14 sgRNA CRISPR Lentivector set (Mouse)
K3839701	ABM	3 x 1.0 ug	EUR 339

Nop14 sgRNA CRISPR Lentivector set (Rat)
K6634701	ABM	3 x 1.0 ug	EUR 339

NOP14-AS1 ORF Vector (Human) (pORF)
ORF026175	ABM	1.0 ug DNA	Ask for price

Human Nucleolar protein 14, NOP14 ELISA KIT
ELI-16701h	Lifescience Market	96 Tests	EUR 824

Mouse Nucleolar protein 14, Nop14 ELISA KIT
ELI-44673m	Lifescience Market	96 Tests	EUR 865

NOP14 sgRNA CRISPR Lentivector (Human) (Target 1)
K1440602	ABM	1.0 ug DNA	EUR 154

NOP14 sgRNA CRISPR Lentivector (Human) (Target 2)
K1440603	ABM	1.0 ug DNA	EUR 154

NOP14 sgRNA CRISPR Lentivector (Human) (Target 3)
K1440604	ABM	1.0 ug DNA	EUR 154

Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3839702	ABM	1.0 ug DNA	EUR 154

Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3839703	ABM	1.0 ug DNA	EUR 154

Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3839704	ABM	1.0 ug DNA	EUR 154

Nop14 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6634702	ABM	1.0 ug DNA	EUR 154

Nop14 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6634703	ABM	1.0 ug DNA	EUR 154

Nop14 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6634704	ABM	1.0 ug DNA	EUR 154

NOP14 Protein Vector (Human) (pPB-C-His)
PV028613	ABM	500 ng	EUR 329

NOP14 Protein Vector (Human) (pPB-N-His)
PV028614	ABM	500 ng	EUR 329

NOP14 Protein Vector (Human) (pPM-C-HA)
PV028615	ABM	500 ng	EUR 329

NOP14 Protein Vector (Human) (pPM-C-His)
PV028616	ABM	500 ng	EUR 329

NOP14 Protein Vector (Mouse) (pPB-C-His)
PV206090	ABM	500 ng	EUR 1065

NOP14 Protein Vector (Mouse) (pPB-N-His)
PV206091	ABM	500 ng	EUR 1065

NOP14 Protein Vector (Mouse) (pPM-C-HA)
PV206092	ABM	500 ng	EUR 1065

NOP14 Protein Vector (Mouse) (pPM-C-His)
PV206093	ABM	500 ng	EUR 1065

NOP14 Protein Vector (Rat) (pPB-C-His)
PV285626	ABM	500 ng	EUR 603

NOP14 Protein Vector (Rat) (pPB-N-His)
PV285627	ABM	500 ng	EUR 603

NOP14 Protein Vector (Rat) (pPM-C-HA)
PV285628	ABM	500 ng	EUR 603

NOP14 Protein Vector (Rat) (pPM-C-His)
PV285629	ABM	500 ng	EUR 603

Nop14 3'UTR GFP Stable Cell Line
TU164208	ABM	1.0 ml	Ask for price

NOP14 3'UTR Luciferase Stable Cell Line
TU015821	ABM	1.0 ml	EUR 1394

Nop14 3'UTR Luciferase Stable Cell Line
TU114208	ABM	1.0 ml	Ask for price

NOP14 3'UTR GFP Stable Cell Line
TU065821	ABM	1.0 ml	EUR 1394

Nop14 3'UTR GFP Stable Cell Line
TU264081	ABM	1.0 ml	Ask for price

Nop14 3'UTR Luciferase Stable Cell Line
TU214081	ABM	1.0 ml	Ask for price

NOP14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV621619	ABM	1.0 ug DNA	EUR 682

NOP14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV621623	ABM	1.0 ug DNA	EUR 682

NOP14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV621624	ABM	1.0 ug DNA	EUR 682

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NOP14 Rabbit Polyclonal Antibody