NOP14 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
NOP14 Polyclonal Antibody |
ES9955-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NOP14 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NOP14 Polyclonal Antibody |
ABP59496-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
- Applications tips:
|
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860 |
NOP14 Polyclonal Antibody |
ABP59496-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
- Applications tips:
|
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860 |
NOP14 Polyclonal Antibody |
ABP59496-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860
- Applications tips:
|
Description: A polyclonal antibody for detection of NOP14 from Human, Mouse. This NOP14 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NOP14 protein at amino acid sequence of 780-860 |
NOP14 Polyclonal Antibody |
27397-100ul |
SAB |
100ul |
EUR 252 |
NOP14 Polyclonal Antibody |
27397-50ul |
SAB |
50ul |
EUR 187 |
NOP14 Rabbit pAb |
A10361-100ul |
Abclonal |
100 ul |
EUR 308 |
NOP14 Rabbit pAb |
A10361-200ul |
Abclonal |
200 ul |
EUR 459 |
NOP14 Rabbit pAb |
A10361-20ul |
Abclonal |
20 ul |
EUR 183 |
NOP14 Rabbit pAb |
A10361-50ul |
Abclonal |
50 ul |
EUR 223 |
NOP14 Polyclonal Conjugated Antibody |
C27397 |
SAB |
100ul |
EUR 397 |
NOP14 Antibody |
20-abx126263 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Anti-NOP14 antibody |
STJ112398 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that plays a role in pre-18s rRNA processing and small ribosomal subunit assembly. The encoded protein may be involved in the regulation of pancreatic cancer cell proliferation and migration. Alternative splicing results in multiple transcript variants. |
Anti-NOP14 antibody |
STJ191113 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NOP14 |
NOP14 siRNA |
20-abx926146 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOP14 siRNA |
20-abx926147 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NOP14 cloning plasmid |
CSB-CL015936HU-10ug |
Cusabio |
10ug |
EUR 474 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2421
- Sequence: atggcgaaggcgaagaaggtcggggcgcgaaggaaggcctccggggcgccggcgggagcgcgagggggcccggcgaaggccaactccaatccgttcgaggtgaaagttaacaggcagaagttccagatcctgggccggaagacgcgccacgacgtgggactgcccggggtgtctc
- Show more
|
Description: A cloning plasmid for the NOP14 gene. |
Mouse NOP14 shRNA Plasmid |
20-abx978393 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NOP14 shRNA Plasmid |
20-abx955650 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NOP14 ORF Vector (Human) (pORF) |
ORF007154 |
ABM |
1.0 ug DNA |
EUR 95 |
Nop14 ORF Vector (Rat) (pORF) |
ORF071407 |
ABM |
1.0 ug DNA |
EUR 506 |
Nop14 ORF Vector (Mouse) (pORF) |
ORF051523 |
ABM |
1.0 ug DNA |
EUR 506 |
NOP14 sgRNA CRISPR Lentivector set (Human) |
K1440601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nop14 sgRNA CRISPR Lentivector set (Mouse) |
K3839701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nop14 sgRNA CRISPR Lentivector set (Rat) |
K6634701 |
ABM |
3 x 1.0 ug |
EUR 339 |
NOP14-AS1 ORF Vector (Human) (pORF) |
ORF026175 |
ABM |
1.0 ug DNA |
Ask for price |
Human Nucleolar protein 14, NOP14 ELISA KIT |
ELI-16701h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Nucleolar protein 14, Nop14 ELISA KIT |
ELI-44673m |
Lifescience Market |
96 Tests |
EUR 865 |
NOP14 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1440602 |
ABM |
1.0 ug DNA |
EUR 154 |
NOP14 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1440603 |
ABM |
1.0 ug DNA |
EUR 154 |
NOP14 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1440604 |
ABM |
1.0 ug DNA |
EUR 154 |
Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3839702 |
ABM |
1.0 ug DNA |
EUR 154 |
Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3839703 |
ABM |
1.0 ug DNA |
EUR 154 |
Nop14 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3839704 |
ABM |
1.0 ug DNA |
EUR 154 |
Nop14 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6634702 |
ABM |
1.0 ug DNA |
EUR 154 |
Nop14 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6634703 |
ABM |
1.0 ug DNA |
EUR 154 |
Nop14 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6634704 |
ABM |
1.0 ug DNA |
EUR 154 |
NOP14 Protein Vector (Human) (pPB-C-His) |
PV028613 |
ABM |
500 ng |
EUR 329 |
NOP14 Protein Vector (Human) (pPB-N-His) |
PV028614 |
ABM |
500 ng |
EUR 329 |
NOP14 Protein Vector (Human) (pPM-C-HA) |
PV028615 |
ABM |
500 ng |
EUR 329 |
NOP14 Protein Vector (Human) (pPM-C-His) |
PV028616 |
ABM |
500 ng |
EUR 329 |
NOP14 Protein Vector (Mouse) (pPB-C-His) |
PV206090 |
ABM |
500 ng |
EUR 1065 |
NOP14 Protein Vector (Mouse) (pPB-N-His) |
PV206091 |
ABM |
500 ng |
EUR 1065 |
NOP14 Protein Vector (Mouse) (pPM-C-HA) |
PV206092 |
ABM |
500 ng |
EUR 1065 |
NOP14 Protein Vector (Mouse) (pPM-C-His) |
PV206093 |
ABM |
500 ng |
EUR 1065 |
NOP14 Protein Vector (Rat) (pPB-C-His) |
PV285626 |
ABM |
500 ng |
EUR 603 |
NOP14 Protein Vector (Rat) (pPB-N-His) |
PV285627 |
ABM |
500 ng |
EUR 603 |
NOP14 Protein Vector (Rat) (pPM-C-HA) |
PV285628 |
ABM |
500 ng |
EUR 603 |
NOP14 Protein Vector (Rat) (pPM-C-His) |
PV285629 |
ABM |
500 ng |
EUR 603 |
Nop14 3'UTR GFP Stable Cell Line |
TU164208 |
ABM |
1.0 ml |
Ask for price |
NOP14 3'UTR Luciferase Stable Cell Line |
TU015821 |
ABM |
1.0 ml |
EUR 1394 |
Nop14 3'UTR Luciferase Stable Cell Line |
TU114208 |
ABM |
1.0 ml |
Ask for price |
NOP14 3'UTR GFP Stable Cell Line |
TU065821 |
ABM |
1.0 ml |
EUR 1394 |
Nop14 3'UTR GFP Stable Cell Line |
TU264081 |
ABM |
1.0 ml |
Ask for price |
Nop14 3'UTR Luciferase Stable Cell Line |
TU214081 |
ABM |
1.0 ml |
Ask for price |
NOP14 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV621619 |
ABM |
1.0 ug DNA |
EUR 682 |
NOP14 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV621623 |
ABM |
1.0 ug DNA |
EUR 682 |
NOP14 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV621624 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NOP14 Rabbit Polyclonal Antibody