NQO2 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

NQO2 Polyclonal Antibody
ABP59518-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of NQO2 from Human, Mouse, Rat. This NQO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120

NQO2 Polyclonal Antibody
ABP59518-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120 Applications tips:
Description: A polyclonal antibody for detection of NQO2 from Human, Mouse, Rat. This NQO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120

NQO2 Polyclonal Antibody
ES10186-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NQO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NQO2 Polyclonal Antibody
ES10186-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NQO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NQO2 Rabbit pAb
A11742-100ul	Abclonal	100 ul	EUR 308

NQO2 Rabbit pAb
A11742-200ul	Abclonal	200 ul	EUR 459

NQO2 Rabbit pAb
A11742-20ul	Abclonal	20 ul	EUR 183

NQO2 Rabbit pAb
A11742-50ul	Abclonal	50 ul	EUR 223

NQO2 Rabbit pAb
A11746-100ul	Abclonal	100 ul	EUR 308

NQO2 Rabbit pAb
A11746-200ul	Abclonal	200 ul	EUR 459

NQO2 Rabbit pAb
A11746-20ul	Abclonal	20 ul	EUR 183

NQO2 Rabbit pAb
A11746-50ul	Abclonal	50 ul	EUR 223

NQO2 Rabbit mAb
A3846-100ul	Abclonal	100 ul	EUR 410

NQO2 Rabbit mAb
A3846-200ul	Abclonal	200 ul	EUR 571

NQO2 Rabbit mAb
A3846-20ul	Abclonal	20 ul	EUR 221

NQO2 Rabbit mAb
A3846-50ul	Abclonal	50 ul	EUR 287

NQO2 Rabbit pAb
A5440-100ul	Abclonal	100 ul	EUR 308

NQO2 Rabbit pAb
A5440-200ul	Abclonal	200 ul	EUR 459

NQO2 Rabbit pAb
A5440-20ul	Abclonal	20 ul	EUR 183

NQO2 Rabbit pAb
A5440-50ul	Abclonal	50 ul	EUR 223

Polyclonal NQO2 Antibody (Center)
APR08809G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NQO2 (Center). This antibody is tested and proven to work in the following applications:

Anti-NQO2 Rabbit Monoclonal Antibody
M03112	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal NQO2 Antibody. Validated in WB and tested in Human, Mouse, Rat.

NQO2 antibody
70R-18947	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NQO2 antibody

NQO2 Antibody
32849-100ul	SAB	100ul	EUR 252

NQO2 antibody
10R-1189	Fitzgerald	100 ul	EUR 316
Description: Mouse monoclonal NQO2 antibody

NQO2 Antibody
49011-100ul	SAB	100ul	EUR 333

NQO2 Antibody
49011-50ul	SAB	50ul	EUR 239

NQO2 Antibody
1-CSB-PA697594	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200

Nqo2 Antibody
1-CSB-PA721470LA01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

NQO2 Antibody
DF7342	Affbiotech	200ul	EUR 304
Description: NQO2 Antibody detects endogenous levels of total NQO2.

NQO2 Antibody
1-CSB-PA016040GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

NQO2 Antibody
1-CSB-PA016040LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

NQO2 Antibody
ABD7342	Lifescience Market	100 ug	EUR 438

Polyclonal NQO2 Antibody (N-term)
APR08811G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NQO2 (N-term). This antibody is tested and proven to work in the following applications:

Nqo2 Polyclonal Antibody, HRP Conjugated
A50974	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Nqo2 Polyclonal Antibody, FITC Conjugated
A50975	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Nqo2 Polyclonal Antibody, Biotin Conjugated
A50976	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Human NQO2 Antibody
33149-05111	AssayPro	150 ug	EUR 261

NQO2 Conjugated Antibody
C49011	SAB	100ul	EUR 397

NQO2 Conjugated Antibody
C32849	SAB	100ul	EUR 397

anti- NQO2 antibody
FNab05831	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:1000-1:4000 IP: 1:500-1:1000 IHC: 1:200-1:800 IF: 1:10-1:100 Immunogen: NAD(P)H dehydrogenase, quinone 2 Uniprot ID: P16083 Gene ID: 4835 Research Area: Metabolism
Description: Antibody raised against NQO2

Anti-NQO2 antibody
PAab05831	Lifescience Market	100 ug	EUR 355

Anti-NQO2 antibody
STJ27393	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants.

Anti-NQO2 antibody
STJ113336	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants.

Anti-NQO2 antibody
STJ113339	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants.

Anti-NQO2 antibody
STJ191344	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NQO2

NQO2 siRNA
20-abx903637	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NQO2 siRNA
20-abx926311	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NQO2 siRNA
20-abx926312	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-NQO2
YF-PA13459	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to NQO2

anti-NQO2
YF-PA13460	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to NQO2

anti-NQO2
YF-PA24252	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to NQO2

Rabbit Anti-NQO2 monoclonal antibody, clone TD17-79
DCABH-7027	Creative Diagnostics	100 ul	EUR 777

Nqo2 Antibody, HRP conjugated
1-CSB-PA721470LB01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Nqo2 Antibody, FITC conjugated
1-CSB-PA721470LC01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Nqo2 Antibody, Biotin conjugated
1-CSB-PA721470LD01RA	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

NQO2 Antibody, HRP conjugated
1-CSB-PA016040LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NQO2 Antibody, FITC conjugated
1-CSB-PA016040LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NQO2 Antibody, Biotin conjugated
1-CSB-PA016040LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NQO2 recombinant monoclonal antibody
A5341	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human NQO2 for WB,ELISA

NQO2 Blocking Peptide
DF7342-BP	Affbiotech	1mg	EUR 195

NQO2 cloning plasmid
CSB-CL016040HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 696 Sequence: atggcaggtaagaaagtactcattgtctatgcacaccaggaacccaagtctttcaacggatccttgaagaatgtggctgtagatgaactgagcaggcagggctgcaccgtcacagtgtctgatttgtatgccatgaactttgagccgagggccacagacaaagatatcactggtac Show more
Description: A cloning plasmid for the NQO2 gene.

Human NQO2 Antibody (Biotin Conjugate)
33149-05121	AssayPro	150 ug	EUR 369

Human NQO2 AssayLite Antibody (FITC Conjugate)
33149-05141	AssayPro	150 ug	EUR 428

Human NQO2 AssayLite Antibody (RPE Conjugate)
33149-05151	AssayPro	150 ug	EUR 428

Human NQO2 AssayLite Antibody (APC Conjugate)
33149-05161	AssayPro	150 ug	EUR 428

Human NQO2 AssayLite Antibody (PerCP Conjugate)
33149-05171	AssayPro	150 ug	EUR 471

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody
20-abx007342	Abbexa	EUR 411.00 EUR 592.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody
abx028209-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody
abx028209-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody
20-abx004165	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody
20-abx212521	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

NQO2 Rabbit Polyclonal Antibody