NQO2 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
NQO2 Polyclonal Antibody |
ABP59518-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of NQO2 from Human, Mouse, Rat. This NQO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120 |
NQO2 Polyclonal Antibody |
ABP59518-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of NQO2 from Human, Mouse, Rat. This NQO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NQO2 protein at amino acid sequence of 40-120 |
NQO2 Polyclonal Antibody |
ES10186-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NQO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NQO2 Polyclonal Antibody |
ES10186-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NQO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NQO2 Rabbit pAb |
A11742-100ul |
Abclonal |
100 ul |
EUR 308 |
NQO2 Rabbit pAb |
A11742-200ul |
Abclonal |
200 ul |
EUR 459 |
NQO2 Rabbit pAb |
A11742-20ul |
Abclonal |
20 ul |
EUR 183 |
NQO2 Rabbit pAb |
A11742-50ul |
Abclonal |
50 ul |
EUR 223 |
NQO2 Rabbit pAb |
A11746-100ul |
Abclonal |
100 ul |
EUR 308 |
NQO2 Rabbit pAb |
A11746-200ul |
Abclonal |
200 ul |
EUR 459 |
NQO2 Rabbit pAb |
A11746-20ul |
Abclonal |
20 ul |
EUR 183 |
NQO2 Rabbit pAb |
A11746-50ul |
Abclonal |
50 ul |
EUR 223 |
NQO2 Rabbit mAb |
A3846-100ul |
Abclonal |
100 ul |
EUR 410 |
NQO2 Rabbit mAb |
A3846-200ul |
Abclonal |
200 ul |
EUR 571 |
NQO2 Rabbit mAb |
A3846-20ul |
Abclonal |
20 ul |
EUR 221 |
NQO2 Rabbit mAb |
A3846-50ul |
Abclonal |
50 ul |
EUR 287 |
NQO2 Rabbit pAb |
A5440-100ul |
Abclonal |
100 ul |
EUR 308 |
NQO2 Rabbit pAb |
A5440-200ul |
Abclonal |
200 ul |
EUR 459 |
NQO2 Rabbit pAb |
A5440-20ul |
Abclonal |
20 ul |
EUR 183 |
NQO2 Rabbit pAb |
A5440-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal NQO2 Antibody (Center) |
APR08809G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NQO2 (Center). This antibody is tested and proven to work in the following applications: |
Anti-NQO2 Rabbit Monoclonal Antibody |
M03112 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal NQO2 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
NQO2 antibody |
70R-18947 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NQO2 antibody |
NQO2 Antibody |
32849-100ul |
SAB |
100ul |
EUR 252 |
NQO2 antibody |
10R-1189 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal NQO2 antibody |
NQO2 Antibody |
49011-100ul |
SAB |
100ul |
EUR 333 |
NQO2 Antibody |
49011-50ul |
SAB |
50ul |
EUR 239 |
NQO2 Antibody |
1-CSB-PA697594 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200 |
Nqo2 Antibody |
1-CSB-PA721470LA01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
NQO2 Antibody |
DF7342 |
Affbiotech |
200ul |
EUR 304 |
Description: NQO2 Antibody detects endogenous levels of total NQO2. |
NQO2 Antibody |
1-CSB-PA016040GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
NQO2 Antibody |
1-CSB-PA016040LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000 |
Polyclonal NQO2 Antibody (N-term) |
APR08811G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NQO2 (N-term). This antibody is tested and proven to work in the following applications: |
Nqo2 Polyclonal Antibody, HRP Conjugated |
A50974 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Nqo2 Polyclonal Antibody, FITC Conjugated |
A50975 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Nqo2 Polyclonal Antibody, Biotin Conjugated |
A50976 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Human NQO2 Antibody |
33149-05111 |
AssayPro |
150 ug |
EUR 261 |
NQO2 Conjugated Antibody |
C49011 |
SAB |
100ul |
EUR 397 |
NQO2 Conjugated Antibody |
C32849 |
SAB |
100ul |
EUR 397 |
anti- NQO2 antibody |
FNab05831 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:1000-1:4000
- IP: 1:500-1:1000
- IHC: 1:200-1:800
- IF: 1:10-1:100
- Immunogen: NAD(P)H dehydrogenase, quinone 2
- Uniprot ID: P16083
- Gene ID: 4835
- Research Area: Metabolism
|
Description: Antibody raised against NQO2 |
Anti-NQO2 antibody |
STJ27393 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. |
Anti-NQO2 antibody |
STJ113336 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. |
Anti-NQO2 antibody |
STJ113339 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. |
Anti-NQO2 antibody |
STJ191344 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NQO2 |
NQO2 siRNA |
20-abx903637 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NQO2 siRNA |
20-abx926311 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NQO2 siRNA |
20-abx926312 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-NQO2 |
YF-PA13459 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to NQO2 |
anti-NQO2 |
YF-PA13460 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to NQO2 |
anti-NQO2 |
YF-PA24252 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to NQO2 |
Nqo2 Antibody, HRP conjugated |
1-CSB-PA721470LB01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA |
Nqo2 Antibody, FITC conjugated |
1-CSB-PA721470LC01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA |
Nqo2 Antibody, Biotin conjugated |
1-CSB-PA721470LD01RA |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Nqo2. Recognizes Nqo2 from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NQO2 Antibody, HRP conjugated |
1-CSB-PA016040LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NQO2 Antibody, FITC conjugated |
1-CSB-PA016040LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NQO2 Antibody, Biotin conjugated |
1-CSB-PA016040LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NQO2. Recognizes NQO2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NQO2 recombinant monoclonal antibody |
A5341 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human NQO2 for WB,ELISA |
NQO2 Blocking Peptide |
DF7342-BP |
Affbiotech |
1mg |
EUR 195 |
NQO2 cloning plasmid |
CSB-CL016040HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 696
- Sequence: atggcaggtaagaaagtactcattgtctatgcacaccaggaacccaagtctttcaacggatccttgaagaatgtggctgtagatgaactgagcaggcagggctgcaccgtcacagtgtctgatttgtatgccatgaactttgagccgagggccacagacaaagatatcactggtac
- Show more
|
Description: A cloning plasmid for the NQO2 gene. |
Human NQO2 Antibody (Biotin Conjugate) |
33149-05121 |
AssayPro |
150 ug |
EUR 369 |
Human NQO2 AssayLite Antibody (FITC Conjugate) |
33149-05141 |
AssayPro |
150 ug |
EUR 428 |
Human NQO2 AssayLite Antibody (RPE Conjugate) |
33149-05151 |
AssayPro |
150 ug |
EUR 428 |
Human NQO2 AssayLite Antibody (APC Conjugate) |
33149-05161 |
AssayPro |
150 ug |
EUR 428 |
Human NQO2 AssayLite Antibody (PerCP Conjugate) |
33149-05171 |
AssayPro |
150 ug |
EUR 471 |
N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody |
20-abx007342 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody |
abx028209-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody |
abx028209-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody |
20-abx004165 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
N-Ribosyldihydronicotinamide:Quinone Reductase 2 (NQO2) Antibody |
20-abx212521 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NQO2 Rabbit Polyclonal Antibody