PAIP1 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
PAIP1 Polyclonal Antibody |
30695-50ul |
SAB |
50ul |
EUR 187 |
PAIP1 Polyclonal Antibody |
ABP59815-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180 |
PAIP1 Polyclonal Antibody |
ABP59815-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180 |
PAIP1 Polyclonal Antibody |
ABP59815-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of PAIP1 from Human, Mouse. This PAIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAIP1 protein at amino acid sequence of 100-180 |
PAIP1 Polyclonal Antibody |
ES10018-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PAIP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAIP1 Polyclonal Antibody |
ES10018-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PAIP1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PAIP1 Rabbit pAb |
A6042-100ul |
Abclonal |
100 ul |
EUR 308 |
PAIP1 Rabbit pAb |
A6042-200ul |
Abclonal |
200 ul |
EUR 459 |
PAIP1 Rabbit pAb |
A6042-20ul |
Abclonal |
20 ul |
EUR 183 |
PAIP1 Rabbit pAb |
A6042-50ul |
Abclonal |
50 ul |
EUR 223 |
PAIP1 Polyclonal Conjugated Antibody |
C30695 |
SAB |
100ul |
EUR 397 |
PAIP1 antibody |
70R-19094 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PAIP1 antibody |
PAIP1 antibody |
70R-1375 |
Fitzgerald |
100 ug |
EUR 377 |
Description: Rabbit polyclonal PAIP1 antibody |
PAIP1 Antibody |
1-CSB-PA880930ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against PAIP1. Recognizes PAIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000 |
PAIP1 Antibody |
1-CSB-PA017400GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PAIP1. Recognizes PAIP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
PAIP1 antibody |
70R-4907 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PAIP1 antibody |
anti- PAIP1 antibody |
FNab06116 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: poly(A) binding protein interacting protein 1
- Uniprot ID: Q9H074
- Gene ID: 10605
- Research Area: Metabolism
|
Description: Antibody raised against PAIP1 |
Anti-PAIP1 antibody |
STJ27838 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. |
Anti-PAIP1 antibody |
STJ191176 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PAIP1 |
PAIP1 siRNA |
20-abx927633 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PAIP1 siRNA |
20-abx927634 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PAIP1 |
YF-PA25626 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PAIP1 |
PAIP1 Blocking Peptide |
33R-2650 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAIP1 antibody, catalog no. 70R-1375 |
PAIP1 Blocking Peptide |
33R-6406 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAIP1 antibody, catalog no. 70R-4907 |
PAIP1 cloning plasmid |
CSB-CL880930HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1203
- Sequence: atgtcggacggtttcgatcgggccccagagcaaacgaggcccctgagagctccacctagttcacaggataaaatcccacagcagaactcggagtcagcaatggctaagccccaggtggttgtagctcctgtattaatgtctaagctgtctgtgaatgcccctgaattttaccctt
- Show more
|
Description: A cloning plasmid for the PAIP1 gene. |
Anti-PAIP1 (7E7) |
YF-MA17395 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to PAIP1 |
Anti-PAIP1 (2D11) |
YF-MA17396 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse monoclonal to PAIP1 |
Human PAIP1 shRNA Plasmid |
20-abx957218 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PAIP1 shRNA Plasmid |
20-abx981209 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PAIP1 Recombinant Protein (Human) |
RP022468 |
ABM |
100 ug |
Ask for price |
PAIP1 Recombinant Protein (Mouse) |
RP159935 |
ABM |
100 ug |
Ask for price |
PAIP1 Recombinant Protein (Mouse) |
RP159938 |
ABM |
100 ug |
Ask for price |
PAIP1 Recombinant Protein (Rat) |
RP219182 |
ABM |
100 ug |
Ask for price |
Paip1 ORF Vector (Rat) (pORF) |
ORF073062 |
ABM |
1.0 ug DNA |
EUR 506 |
PAIP1 ORF Vector (Human) (pORF) |
ORF007490 |
ABM |
1.0 ug DNA |
EUR 95 |
Paip1 ORF Vector (Mouse) (pORF) |
ORF053313 |
ABM |
1.0 ug DNA |
EUR 506 |
Paip1 ORF Vector (Mouse) (pORF) |
ORF053314 |
ABM |
1.0 ug DNA |
EUR 506 |
Paip1 sgRNA CRISPR Lentivector set (Rat) |
K6112701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Paip1 sgRNA CRISPR Lentivector set (Mouse) |
K4580901 |
ABM |
3 x 1.0 ug |
EUR 339 |
PAIP1 sgRNA CRISPR Lentivector set (Human) |
K1589401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
20-abx004650 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
20-abx142125 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
abx030721-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
abx030721-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
abx340003-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
20-abx321424 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
abx236116-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Poly(A) Binding Protein Interacting Protein 1 (PAIP1) Antibody |
abx236117-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Paip1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6112702 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6112703 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6112704 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4580902 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4580903 |
ABM |
1.0 ug DNA |
EUR 154 |
Paip1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4580904 |
ABM |
1.0 ug DNA |
EUR 154 |
PAIP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1589402 |
ABM |
1.0 ug DNA |
EUR 154 |
PAIP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1589403 |
ABM |
1.0 ug DNA |
EUR 154 |
PAIP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1589404 |
ABM |
1.0 ug DNA |
EUR 154 |
PAIP1 Protein Vector (Rat) (pPB-C-His) |
PV292246 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Rat) (pPB-N-His) |
PV292247 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Rat) (pPM-C-HA) |
PV292248 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Rat) (pPM-C-His) |
PV292249 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPB-C-His) |
PV213250 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPB-N-His) |
PV213251 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPM-C-HA) |
PV213252 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPM-C-His) |
PV213253 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPB-C-His) |
PV213254 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPB-N-His) |
PV213255 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPM-C-HA) |
PV213256 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Mouse) (pPM-C-His) |
PV213257 |
ABM |
500 ng |
EUR 603 |
PAIP1 Protein Vector (Human) (pPB-C-His) |
PV029957 |
ABM |
500 ng |
EUR 329 |
PAIP1 Protein Vector (Human) (pPB-N-His) |
PV029958 |
ABM |
500 ng |
EUR 329 |
PAIP1 Protein Vector (Human) (pPM-C-HA) |
PV029959 |
ABM |
500 ng |
EUR 329 |
PAIP1 Protein Vector (Human) (pPM-C-His) |
PV029960 |
ABM |
500 ng |
EUR 329 |
Paip1 3'UTR Luciferase Stable Cell Line |
TU115857 |
ABM |
1.0 ml |
Ask for price |
Paip1 3'UTR GFP Stable Cell Line |
TU165857 |
ABM |
1.0 ml |
Ask for price |
Paip1 3'UTR GFP Stable Cell Line |
TU265768 |
ABM |
1.0 ml |
Ask for price |
Paip1 3'UTR Luciferase Stable Cell Line |
TU215768 |
ABM |
1.0 ml |
Ask for price |
PAIP1 3'UTR GFP Stable Cell Line |
TU067340 |
ABM |
1.0 ml |
EUR 1394 |
PAIP1 3'UTR Luciferase Stable Cell Line |
TU017340 |
ABM |
1.0 ml |
EUR 1394 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
PAIP1 Rabbit Polyclonal Antibody