PDK3 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PDK3 Polyclonal Antibody
ABP59869-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody
ABP59869-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody
ABP59869-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250 Applications tips:
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250

PDK3 Polyclonal Antibody
31423-100ul	SAB	100ul	EUR 252

PDK3 Polyclonal Antibody
31423-50ul	SAB	50ul	EUR 187

PDK3 Polyclonal Antibody
27701-100ul	SAB	100ul	EUR 252

PDK3 Polyclonal Antibody
27701-50ul	SAB	50ul	EUR 187

PDK3 Rabbit pAb
A12480-100ul	Abclonal	100 ul	EUR 308

PDK3 Rabbit pAb
A12480-200ul	Abclonal	200 ul	EUR 459

PDK3 Rabbit pAb
A12480-20ul	Abclonal	20 ul	EUR 183

PDK3 Rabbit pAb
A12480-50ul	Abclonal	50 ul	EUR 223

PDK3 Rabbit pAb
A8028-100ul	Abclonal	100 ul	EUR 308

PDK3 Rabbit pAb
A8028-200ul	Abclonal	200 ul	EUR 459

PDK3 Rabbit pAb
A8028-20ul	Abclonal	20 ul	EUR 183

PDK3 Rabbit pAb
A8028-50ul	Abclonal	50 ul	EUR 223

PDK3 Polyclonal Conjugated Antibody
C31423	SAB	100ul	EUR 397

PDK3 Polyclonal Conjugated Antibody
C27701	SAB	100ul	EUR 397

PDK3 antibody
70R-2460	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PDK3 antibody raised against the middle region of PDK3

PDK3 antibody
70R-2492	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PDK3 antibody raised against the N terminal of PDK3

PDK3 Antibody
39575-100ul	SAB	100ul	EUR 390

PDK3 Antibody
1-CSB-PA613585ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PDK3. Recognizes PDK3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Pdk3 Antibody
1-CSB-PA852852LA01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse, Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

Polyclonal PDK3 Antibody (N-term)
APR10823G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDK3 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal Mouse Pdk3 Antibody (C-term)
APR07135G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Pdk3 (C-term). This antibody is tested and proven to work in the following applications:

anti- PDK3 antibody
FNab06278	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: pyruvate dehydrogenase kinase, isozyme 3 Uniprot ID: Q15120 Gene ID: 5165 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against PDK3

Mouse Pdk3 Antibody
abx027930-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Mouse Pdk3 Antibody
abx027930-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Anti-PDK3 antibody
PAab06278	Lifescience Market	100 ug	EUR 386

Anti-PDK3 antibody
STJ110334	St John's Laboratory	100 µl	EUR 277
Description: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PDK3 antibody
STJ114354	St John's Laboratory	100 µl	EUR 277
Description: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-PDK3 antibody
STJ191232	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PDK3

PDK3 siRNA
20-abx928148	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PDK3 siRNA
20-abx928149	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PDK3
YF-PA13700	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to PDK3

Pdk3 Antibody, HRP conjugated
1-CSB-PA852852LB01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Pdk3 Antibody, FITC conjugated
1-CSB-PA852852LC01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Pdk3 Antibody, Biotin conjugated
1-CSB-PA852852LD01MO	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Antibody for Human PDK3
SPC-1188D	Stressmarq	0.1ml	EUR 354
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is unconjugated.

Antibody for Human PDK3
SPC-1188D-A390	Stressmarq	0.1ml	EUR 401
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 390.

Antibody for Human PDK3
SPC-1188D-A488	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 488.

Antibody for Human PDK3
SPC-1188D-A565	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 565.

Antibody for Human PDK3
SPC-1188D-A594	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 594.

Antibody for Human PDK3
SPC-1188D-A633	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 633.

Antibody for Human PDK3
SPC-1188D-A655	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 655.

Antibody for Human PDK3
SPC-1188D-A680	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 680.

Antibody for Human PDK3
SPC-1188D-A700	Stressmarq	0.1ml	EUR 400
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 700.

Antibody for Human PDK3
SPC-1188D-ALP	Stressmarq	0.1ml	EUR 394
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human PDK3
SPC-1188D-APC	Stressmarq	0.1ml	EUR 399
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to APC .

Antibody for Human PDK3
SPC-1188D-APCCY7	Stressmarq	0.1ml	EUR 471
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to APC/Cy7.

Antibody for Human PDK3
SPC-1188D-BI	Stressmarq	0.1ml	EUR 396
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Biotin.

Antibody for Human PDK3
SPC-1188D-DY350	Stressmarq	0.1ml	EUR 475
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 350.

Antibody for Human PDK3
SPC-1188D-DY405	Stressmarq	0.1ml	EUR 452
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 405.

Antibody for Human PDK3
SPC-1188D-DY488	Stressmarq	0.1ml	EUR 432
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 488.

Antibody for Human PDK3
SPC-1188D-DY594	Stressmarq	0.1ml	EUR 436
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 594.

Antibody for Human PDK3
SPC-1188D-DY633	Stressmarq	0.1ml	EUR 426
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 633.

Antibody for Human PDK3
SPC-1188D-FITC	Stressmarq	0.1ml	EUR 392
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to FITC.

Antibody for Human PDK3
SPC-1188D-HRP	Stressmarq	0.1ml	EUR 388
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to HRP.

Antibody for Human PDK3
SPC-1188D-P594	Stressmarq	0.1ml	EUR 407
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to PE/ATTO 594.

Antibody for Human PDK3
SPC-1188D-PCP	Stressmarq	0.1ml	EUR 399
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to PerCP.

Antibody for Human PDK3
SPC-1188D-RPE	Stressmarq	0.1ml	EUR 397
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to RPE .

Antibody for Human PDK3
SPC-1188D-STR	Stressmarq	0.1ml	EUR 398
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Streptavidin.

PDK3 cloning plasmid
CSB-CL613585HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1221 Sequence: atgcggctgttccggtggctgctgaagcagccggtgcccaagcagatcgagcgctactcgcgcttttcgccgtcgccgctctccatcaaacaattcctggacttcgggagagataatgcatgtgagaaaacttcatatatgtttctacgaaaggaacttcctgtgcggctggcta Show more
Description: A cloning plasmid for the PDK3 gene.

PDK3 Blocking Peptide
33R-4222	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDK3 antibody, catalog no. 70R-2460

PDK3 Blocking Peptide
33R-8109	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDK3 antibody, catalog no. 70R-2492

pCMV-SPORT6-PDK3
PVT13165	Lifescience Market	2 ug	EUR 391

Anti-PDK3 (3A1)
YF-MA14656	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PDK3

Anti-PDK3 (1G11)
YF-MA14657	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PDK3

Anti-PDK3 (2B11)
YF-MA10681	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PDK3

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse)
4-PAD463Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3)

Human PDK3 ELISA KIT
ELI-21524h	Lifescience Market	96 Tests	EUR 824

PDK3 ELISA KIT|Human
EF001655	Lifescience Market	96 Tests	EUR 689

Mouse Pdk3 ELISA KIT
ELI-37725m	Lifescience Market	96 Tests	EUR 865

Human PDK3 shRNA Plasmid
20-abx953445	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PDK3 shRNA Plasmid
20-abx982257	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PDK3 Recombinant Protein (Human)
RP022942	ABM	100 ug	Ask for price

PDK3 Recombinant Protein (Rat)
RP219902	ABM	100 ug	Ask for price

PDK3 Recombinant Protein (Mouse)
RP161093	ABM	100 ug	Ask for price

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), APC
4-PAD463Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with APC.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), Biotinylated
4-PAD463Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with Biotin.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), Cy3
4-PAD463Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with Cy3.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), FITC
4-PAD463Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with FITC.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), HRP
4-PAD463Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with HRP.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), PE
4-PAD463Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with PE.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), APC-Cy7
4-PAD463Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PDK3 (Gly138~Pro396) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with APC-Cy7.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
20-abx129416	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
abx036493-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
abx033137-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
abx033137-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
20-abx006057	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
20-abx322661	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
20-abx338957	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody
abx236278-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

PDK3 ORF Vector (Human) (pORF)
ORF007648	ABM	1.0 ug DNA	EUR 95

h PDK3 inducible lentiviral particles
LVP060	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PDK3, is fully sequence verified and matched to NCBI accession ID: NM_005391.4

Pdk3 ORF Vector (Rat) (pORF)
ORF073302	ABM	1.0 ug DNA	EUR 506

Pdk3 ORF Vector (Mouse) (pORF)
ORF053699	ABM	1.0 ug DNA	EUR 506

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (HRP)
20-abx338936	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (FITC)
20-abx338937	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (Biotin)
20-abx338938	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PDK3 sgRNA CRISPR Lentivector set (Human)
K1622201	ABM	3 x 1.0 ug	EUR 339

Pdk3 sgRNA CRISPR Lentivector set (Mouse)
K4229601	ABM	3 x 1.0 ug	EUR 339

Pdk3 sgRNA CRISPR Lentivector set (Rat)
K6709901	ABM	3 x 1.0 ug	EUR 339

PDK3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1622202	ABM	1.0 ug DNA	EUR 154

PDK3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1622203	ABM	1.0 ug DNA	EUR 154

PDK3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1622204	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4229602	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4229603	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4229604	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6709902	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6709903	ABM	1.0 ug DNA	EUR 154

Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6709904	ABM	1.0 ug DNA	EUR 154

Recombinant Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3)
4-RPD463Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q922H2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.1KDa Isoelectric Point: Inquire
Description: Recombinant Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 expressed in: E.coli

PDK3 Protein Vector (Human) (pPB-C-His)
PV030589	ABM	500 ng	EUR 329

PDK3 Protein Vector (Human) (pPB-N-His)
PV030590	ABM	500 ng	EUR 329

PDK3 Protein Vector (Human) (pPM-C-HA)
PV030591	ABM	500 ng	EUR 329

PDK3 Protein Vector (Human) (pPM-C-His)
PV030592	ABM	500 ng	EUR 329

PDK3 Protein Vector (Mouse) (pPB-C-His)
PV214794	ABM	500 ng	EUR 603

PDK3 Protein Vector (Mouse) (pPB-N-His)
PV214795	ABM	500 ng	EUR 603

PDK3 Protein Vector (Mouse) (pPM-C-HA)
PV214796	ABM	500 ng	EUR 603

PDK3 Protein Vector (Mouse) (pPM-C-His)
PV214797	ABM	500 ng	EUR 603

PDK3 Protein Vector (Rat) (pPB-C-His)
PV293206	ABM	500 ng	EUR 603

PDK3 Protein Vector (Rat) (pPB-N-His)
PV293207	ABM	500 ng	EUR 603

PDK3 Protein Vector (Rat) (pPM-C-HA)
PV293208	ABM	500 ng	EUR 603

PDK3 Protein Vector (Rat) (pPM-C-His)
PV293209	ABM	500 ng	EUR 603

Pdk3 3'UTR GFP Stable Cell Line
TU166142	ABM	1.0 ml	Ask for price

PDK3 3'UTR Luciferase Stable Cell Line
TU017674	ABM	1.0 ml	EUR 1394

Pdk3 3'UTR Luciferase Stable Cell Line
TU116142	ABM	1.0 ml	Ask for price

PDK3 3'UTR GFP Stable Cell Line
TU067674	ABM	1.0 ml	EUR 1394

Pdk3 3'UTR GFP Stable Cell Line
TU266031	ABM	1.0 ml	Ask for price

Pdk3 3'UTR Luciferase Stable Cell Line
TU216031	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ERK1 Rabbit Polyclonal Antibody
ES8583-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

PDK3 Rabbit Polyclonal Antibody