PDK3 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
PDK3 Polyclonal Antibody |
ABP59869-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250 |
PDK3 Polyclonal Antibody |
ABP59869-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250 |
PDK3 Polyclonal Antibody |
ABP59869-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250
- Applications tips:
|
Description: A polyclonal antibody for detection of PDK3 from Human, Mouse. This PDK3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PDK3 protein at amino acid sequence of 170-250 |
PDK3 Polyclonal Antibody |
31423-100ul |
SAB |
100ul |
EUR 252 |
PDK3 Polyclonal Antibody |
31423-50ul |
SAB |
50ul |
EUR 187 |
PDK3 Polyclonal Antibody |
27701-100ul |
SAB |
100ul |
EUR 252 |
PDK3 Polyclonal Antibody |
27701-50ul |
SAB |
50ul |
EUR 187 |
PDK3 Rabbit pAb |
A12480-100ul |
Abclonal |
100 ul |
EUR 308 |
PDK3 Rabbit pAb |
A12480-200ul |
Abclonal |
200 ul |
EUR 459 |
PDK3 Rabbit pAb |
A12480-20ul |
Abclonal |
20 ul |
EUR 183 |
PDK3 Rabbit pAb |
A12480-50ul |
Abclonal |
50 ul |
EUR 223 |
PDK3 Rabbit pAb |
A8028-100ul |
Abclonal |
100 ul |
EUR 308 |
PDK3 Rabbit pAb |
A8028-200ul |
Abclonal |
200 ul |
EUR 459 |
PDK3 Rabbit pAb |
A8028-20ul |
Abclonal |
20 ul |
EUR 183 |
PDK3 Rabbit pAb |
A8028-50ul |
Abclonal |
50 ul |
EUR 223 |
PDK3 Polyclonal Conjugated Antibody |
C31423 |
SAB |
100ul |
EUR 397 |
PDK3 Polyclonal Conjugated Antibody |
C27701 |
SAB |
100ul |
EUR 397 |
PDK3 antibody |
70R-2460 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PDK3 antibody raised against the middle region of PDK3 |
PDK3 antibody |
70R-2492 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PDK3 antibody raised against the N terminal of PDK3 |
PDK3 Antibody |
39575-100ul |
SAB |
100ul |
EUR 390 |
PDK3 Antibody |
1-CSB-PA613585ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against PDK3. Recognizes PDK3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
Pdk3 Antibody |
1-CSB-PA852852LA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse, Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000 |
Polyclonal PDK3 Antibody (N-term) |
APR10823G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PDK3 (N-term). This antibody is tested and proven to work in the following applications: |
Polyclonal Mouse Pdk3 Antibody (C-term) |
APR07135G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Pdk3 (C-term). This antibody is tested and proven to work in the following applications: |
anti- PDK3 antibody |
FNab06278 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: pyruvate dehydrogenase kinase, isozyme 3
- Uniprot ID: Q15120
- Gene ID: 5165
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against PDK3 |
Mouse Pdk3 Antibody |
abx027930-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Mouse Pdk3 Antibody |
abx027930-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Anti-PDK3 antibody |
STJ110334 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-PDK3 antibody |
STJ114354 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-PDK3 antibody |
STJ191232 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PDK3 |
PDK3 siRNA |
20-abx928148 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PDK3 siRNA |
20-abx928149 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PDK3 |
YF-PA13700 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to PDK3 |
Pdk3 Antibody, HRP conjugated |
1-CSB-PA852852LB01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
Pdk3 Antibody, FITC conjugated |
1-CSB-PA852852LC01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
Pdk3 Antibody, Biotin conjugated |
1-CSB-PA852852LD01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Pdk3. Recognizes Pdk3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Antibody for Human PDK3 |
SPC-1188D |
Stressmarq |
0.1ml |
EUR 354 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is unconjugated. |
Antibody for Human PDK3 |
SPC-1188D-A390 |
Stressmarq |
0.1ml |
EUR 401 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 390. |
Antibody for Human PDK3 |
SPC-1188D-A488 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 488. |
Antibody for Human PDK3 |
SPC-1188D-A565 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 565. |
Antibody for Human PDK3 |
SPC-1188D-A594 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 594. |
Antibody for Human PDK3 |
SPC-1188D-A633 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 633. |
Antibody for Human PDK3 |
SPC-1188D-A655 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 655. |
Antibody for Human PDK3 |
SPC-1188D-A680 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 680. |
Antibody for Human PDK3 |
SPC-1188D-A700 |
Stressmarq |
0.1ml |
EUR 400 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to ATTO 700. |
Antibody for Human PDK3 |
SPC-1188D-ALP |
Stressmarq |
0.1ml |
EUR 394 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human PDK3 |
SPC-1188D-APC |
Stressmarq |
0.1ml |
EUR 399 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to APC . |
Antibody for Human PDK3 |
SPC-1188D-APCCY7 |
Stressmarq |
0.1ml |
EUR 471 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to APC/Cy7. |
Antibody for Human PDK3 |
SPC-1188D-BI |
Stressmarq |
0.1ml |
EUR 396 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Biotin. |
Antibody for Human PDK3 |
SPC-1188D-DY350 |
Stressmarq |
0.1ml |
EUR 475 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 350. |
Antibody for Human PDK3 |
SPC-1188D-DY405 |
Stressmarq |
0.1ml |
EUR 452 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 405. |
Antibody for Human PDK3 |
SPC-1188D-DY488 |
Stressmarq |
0.1ml |
EUR 432 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 488. |
Antibody for Human PDK3 |
SPC-1188D-DY594 |
Stressmarq |
0.1ml |
EUR 436 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 594. |
Antibody for Human PDK3 |
SPC-1188D-DY633 |
Stressmarq |
0.1ml |
EUR 426 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Dylight 633. |
Antibody for Human PDK3 |
SPC-1188D-FITC |
Stressmarq |
0.1ml |
EUR 392 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to FITC. |
Antibody for Human PDK3 |
SPC-1188D-HRP |
Stressmarq |
0.1ml |
EUR 388 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to HRP. |
Antibody for Human PDK3 |
SPC-1188D-P594 |
Stressmarq |
0.1ml |
EUR 407 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to PE/ATTO 594. |
Antibody for Human PDK3 |
SPC-1188D-PCP |
Stressmarq |
0.1ml |
EUR 399 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to PerCP. |
Antibody for Human PDK3 |
SPC-1188D-RPE |
Stressmarq |
0.1ml |
EUR 397 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to RPE . |
Antibody for Human PDK3 |
SPC-1188D-STR |
Stressmarq |
0.1ml |
EUR 398 |
Description: A polyclonal antibody for PDK3 from Human | Mouse. The antibody is produced in rabbit after immunization with human synthetic peptide of human PDK3 (AA92-106). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This PDK3 antibody is conjugated to Streptavidin. |
PDK3 cloning plasmid |
CSB-CL613585HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1221
- Sequence: atgcggctgttccggtggctgctgaagcagccggtgcccaagcagatcgagcgctactcgcgcttttcgccgtcgccgctctccatcaaacaattcctggacttcgggagagataatgcatgtgagaaaacttcatatatgtttctacgaaaggaacttcctgtgcggctggcta
- Show more
|
Description: A cloning plasmid for the PDK3 gene. |
PDK3 Blocking Peptide |
33R-4222 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDK3 antibody, catalog no. 70R-2460 |
PDK3 Blocking Peptide |
33R-8109 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PDK3 antibody, catalog no. 70R-2492 |
Anti-PDK3 (3A1) |
YF-MA14656 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PDK3 |
Anti-PDK3 (1G11) |
YF-MA14657 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PDK3 |
Anti-PDK3 (2B11) |
YF-MA10681 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PDK3 |
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse) |
4-PAD463Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDK3 (Gly138~Pro396)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) |
Human PDK3 shRNA Plasmid |
20-abx953445 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PDK3 shRNA Plasmid |
20-abx982257 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PDK3 Recombinant Protein (Human) |
RP022942 |
ABM |
100 ug |
Ask for price |
PDK3 Recombinant Protein (Rat) |
RP219902 |
ABM |
100 ug |
Ask for price |
PDK3 Recombinant Protein (Mouse) |
RP161093 |
ABM |
100 ug |
Ask for price |
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), APC |
4-PAD463Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDK3 (Gly138~Pro396)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with APC. |
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), Biotinylated |
4-PAD463Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDK3 (Gly138~Pro396)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with Biotin. |
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), Cy3 |
4-PAD463Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDK3 (Gly138~Pro396)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with Cy3. |
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), FITC |
4-PAD463Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDK3 (Gly138~Pro396)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with FITC. |
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), HRP |
4-PAD463Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDK3 (Gly138~Pro396)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with HRP. |
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), PE |
4-PAD463Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDK3 (Gly138~Pro396)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with PE. |
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAD463Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: PDK3 (Gly138~Pro396)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3). This antibody is labeled with APC-Cy7. |
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody |
20-abx129416 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody |
abx036493-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody |
abx033137-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody |
abx033137-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody |
20-abx006057 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody |
20-abx322661 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody |
20-abx338957 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody |
abx236278-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
PDK3 ORF Vector (Human) (pORF) |
ORF007648 |
ABM |
1.0 ug DNA |
EUR 95 |
h PDK3 inducible lentiviral particles |
LVP060 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, PDK3, is fully sequence verified and matched to NCBI accession ID: NM_005391.4 |
Pdk3 ORF Vector (Rat) (pORF) |
ORF073302 |
ABM |
1.0 ug DNA |
EUR 506 |
Pdk3 ORF Vector (Mouse) (pORF) |
ORF053699 |
ABM |
1.0 ug DNA |
EUR 506 |
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (HRP) |
20-abx338936 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (FITC) |
20-abx338937 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) Antibody (Biotin) |
20-abx338938 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PDK3 sgRNA CRISPR Lentivector set (Human) |
K1622201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pdk3 sgRNA CRISPR Lentivector set (Mouse) |
K4229601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pdk3 sgRNA CRISPR Lentivector set (Rat) |
K6709901 |
ABM |
3 x 1.0 ug |
EUR 339 |
PDK3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1622202 |
ABM |
1.0 ug DNA |
EUR 154 |
PDK3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1622203 |
ABM |
1.0 ug DNA |
EUR 154 |
PDK3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1622204 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4229602 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4229603 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdk3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4229604 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6709902 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6709903 |
ABM |
1.0 ug DNA |
EUR 154 |
Pdk3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6709904 |
ABM |
1.0 ug DNA |
EUR 154 |
Recombinant Pyruvate Dehydrogenase Kinase Isozyme 3 (PDK3) |
4-RPD463Mu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q922H2
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 33.1KDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Pyruvate Dehydrogenase Kinase Isozyme 3 expressed in: E.coli |
PDK3 Protein Vector (Human) (pPB-C-His) |
PV030589 |
ABM |
500 ng |
EUR 329 |
PDK3 Protein Vector (Human) (pPB-N-His) |
PV030590 |
ABM |
500 ng |
EUR 329 |
PDK3 Protein Vector (Human) (pPM-C-HA) |
PV030591 |
ABM |
500 ng |
EUR 329 |
PDK3 Protein Vector (Human) (pPM-C-His) |
PV030592 |
ABM |
500 ng |
EUR 329 |
PDK3 Protein Vector (Mouse) (pPB-C-His) |
PV214794 |
ABM |
500 ng |
EUR 603 |
PDK3 Protein Vector (Mouse) (pPB-N-His) |
PV214795 |
ABM |
500 ng |
EUR 603 |
PDK3 Protein Vector (Mouse) (pPM-C-HA) |
PV214796 |
ABM |
500 ng |
EUR 603 |
PDK3 Protein Vector (Mouse) (pPM-C-His) |
PV214797 |
ABM |
500 ng |
EUR 603 |
PDK3 Protein Vector (Rat) (pPB-C-His) |
PV293206 |
ABM |
500 ng |
EUR 603 |
PDK3 Protein Vector (Rat) (pPB-N-His) |
PV293207 |
ABM |
500 ng |
EUR 603 |
PDK3 Protein Vector (Rat) (pPM-C-HA) |
PV293208 |
ABM |
500 ng |
EUR 603 |
PDK3 Protein Vector (Rat) (pPM-C-His) |
PV293209 |
ABM |
500 ng |
EUR 603 |
Pdk3 3'UTR GFP Stable Cell Line |
TU166142 |
ABM |
1.0 ml |
Ask for price |
PDK3 3'UTR Luciferase Stable Cell Line |
TU017674 |
ABM |
1.0 ml |
EUR 1394 |
Pdk3 3'UTR Luciferase Stable Cell Line |
TU116142 |
ABM |
1.0 ml |
Ask for price |
PDK3 3'UTR GFP Stable Cell Line |
TU067674 |
ABM |
1.0 ml |
EUR 1394 |
Pdk3 3'UTR GFP Stable Cell Line |
TU266031 |
ABM |
1.0 ml |
Ask for price |
Pdk3 3'UTR Luciferase Stable Cell Line |
TU216031 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
PDK3 Rabbit Polyclonal Antibody