PEX13 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
PEX13 Polyclonal Antibody |
ES9979-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PEX13 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PEX13 Polyclonal Antibody |
ES9979-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PEX13 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PEX13 Polyclonal Antibody |
ABP59880-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370
- Applications tips:
|
Description: A polyclonal antibody for detection of PEX13 from Human, Mouse. This PEX13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370 |
PEX13 Polyclonal Antibody |
ABP59880-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370
- Applications tips:
|
Description: A polyclonal antibody for detection of PEX13 from Human, Mouse. This PEX13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370 |
PEX13 Polyclonal Antibody |
ABP59880-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370
- Applications tips:
|
Description: A polyclonal antibody for detection of PEX13 from Human, Mouse. This PEX13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PEX13 protein at amino acid sequence of 290-370 |
PEX13 Polyclonal Antibody |
A69111 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
PEX13 antibody |
70R-12990 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal PEX13 antibody |
PEX13 Antibody |
1-CSB-PA849799LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500 |
Polyclonal PEX13 Antibody (C-Term) |
AMM07099G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PEX13 (C-Term). This antibody is tested and proven to work in the following applications: |
PEX13 Polyclonal Antibody, HRP Conjugated |
A69112 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
PEX13 Polyclonal Antibody, FITC Conjugated |
A69113 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: The best epigenetics products |
PEX13 Polyclonal Antibody, Biotin Conjugated |
A69114 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
Anti-PEX13 antibody |
STJ191137 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PEX13 |
PEX13 siRNA |
20-abx928276 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PEX13 siRNA |
20-abx928277 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PEX13 Antibody, HRP conjugated |
1-CSB-PA849799LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PEX13 Antibody, FITC conjugated |
1-CSB-PA849799LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PEX13 Antibody, Biotin conjugated |
1-CSB-PA849799LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PEX13. Recognizes PEX13 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Mouse Peroxisomal membrane protein PEX13, Pex13 ELISA KIT |
ELI-16039m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine Peroxisomal membrane protein PEX13, PEX13 ELISA KIT |
ELI-37434b |
Lifescience Market |
96 Tests |
EUR 928 |
Human Peroxisomal membrane protein PEX13, PEX13 ELISA KIT |
ELI-43690h |
Lifescience Market |
96 Tests |
EUR 824 |
PEX13 cloning plasmid |
CSB-CL849799HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1212
- Sequence: atggcgtcccagccgccacctccccccaaaccctgggagacccgccgaattccgggagccggaccgggaccaggaccgggccccactttccaatctgctgatttgggtcctactttaatgacaagacctggacaaccagcacttaccagagtgcccccacctattcttccaaggc
- Show more
|
Description: A cloning plasmid for the PEX13 gene. |
Mouse PEX13 shRNA Plasmid |
20-abx977682 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PEX13 shRNA Plasmid |
20-abx953466 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PEX13 Recombinant Protein (Human) |
RP023128 |
ABM |
100 ug |
Ask for price |
PEX13 Recombinant Protein (Rat) |
RP220082 |
ABM |
100 ug |
Ask for price |
PEX13 Recombinant Protein (Mouse) |
RP161381 |
ABM |
100 ug |
Ask for price |
Peroxisomal Biogenesis Factor 13 (PEX13) Antibody |
20-abx338710 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peroxisomal Biogenesis Factor 13 (PEX13) Antibody |
abx433119-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (HRP) |
20-abx336976 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (FITC) |
20-abx336977 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Peroxisomal Biogenesis Factor 13 (PEX13) Antibody (Biotin) |
20-abx336978 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PEX13 ORF Vector (Human) (pORF) |
ORF007710 |
ABM |
1.0 ug DNA |
EUR 95 |
Pex13 ORF Vector (Rat) (pORF) |
ORF073362 |
ABM |
1.0 ug DNA |
EUR 506 |
Pex13 ORF Vector (Mouse) (pORF) |
ORF053795 |
ABM |
1.0 ug DNA |
EUR 506 |
PEX13 sgRNA CRISPR Lentivector set (Human) |
K1629601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pex13 sgRNA CRISPR Lentivector set (Mouse) |
K4637501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pex13 sgRNA CRISPR Lentivector set (Rat) |
K6176001 |
ABM |
3 x 1.0 ug |
EUR 339 |
PEX13 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1629602 |
ABM |
1.0 ug DNA |
EUR 154 |
PEX13 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1629603 |
ABM |
1.0 ug DNA |
EUR 154 |
PEX13 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1629604 |
ABM |
1.0 ug DNA |
EUR 154 |
Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4637502 |
ABM |
1.0 ug DNA |
EUR 154 |
Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4637503 |
ABM |
1.0 ug DNA |
EUR 154 |
Pex13 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4637504 |
ABM |
1.0 ug DNA |
EUR 154 |
Pex13 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6176002 |
ABM |
1.0 ug DNA |
EUR 154 |
Pex13 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6176003 |
ABM |
1.0 ug DNA |
EUR 154 |
Pex13 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6176004 |
ABM |
1.0 ug DNA |
EUR 154 |
PEX13 Protein Vector (Human) (pPB-C-His) |
PV030837 |
ABM |
500 ng |
EUR 329 |
PEX13 Protein Vector (Human) (pPB-N-His) |
PV030838 |
ABM |
500 ng |
EUR 329 |
PEX13 Protein Vector (Human) (pPM-C-HA) |
PV030839 |
ABM |
500 ng |
EUR 329 |
PEX13 Protein Vector (Human) (pPM-C-His) |
PV030840 |
ABM |
500 ng |
EUR 329 |
PEX13 Protein Vector (Mouse) (pPB-C-His) |
PV215178 |
ABM |
500 ng |
EUR 603 |
PEX13 Protein Vector (Mouse) (pPB-N-His) |
PV215179 |
ABM |
500 ng |
EUR 603 |
PEX13 Protein Vector (Mouse) (pPM-C-HA) |
PV215180 |
ABM |
500 ng |
EUR 603 |
PEX13 Protein Vector (Mouse) (pPM-C-His) |
PV215181 |
ABM |
500 ng |
EUR 603 |
PEX13 Protein Vector (Rat) (pPB-C-His) |
PV293446 |
ABM |
500 ng |
EUR 603 |
PEX13 Protein Vector (Rat) (pPB-N-His) |
PV293447 |
ABM |
500 ng |
EUR 603 |
PEX13 Protein Vector (Rat) (pPM-C-HA) |
PV293448 |
ABM |
500 ng |
EUR 603 |
PEX13 Protein Vector (Rat) (pPM-C-His) |
PV293449 |
ABM |
500 ng |
EUR 603 |
Pex13 3'UTR GFP Stable Cell Line |
TU166209 |
ABM |
1.0 ml |
Ask for price |
PEX13 3'UTR Luciferase Stable Cell Line |
TU017754 |
ABM |
1.0 ml |
EUR 4617 |
Pex13 3'UTR Luciferase Stable Cell Line |
TU116209 |
ABM |
1.0 ml |
Ask for price |
PEX13 3'UTR GFP Stable Cell Line |
TU067754 |
ABM |
1.0 ml |
EUR 4617 |
Pex13 3'UTR GFP Stable Cell Line |
TU266094 |
ABM |
1.0 ml |
Ask for price |
Pex13 3'UTR Luciferase Stable Cell Line |
TU216094 |
ABM |
1.0 ml |
Ask for price |
Recombinant Pichia pastoris PEX13 Protein (aa 252-380) |
VAng-Cr6649-1mgEcoli |
Creative Biolabs |
1 mg (E. coli) |
EUR 3514 |
Description: Pichia pastoris Peroxisomal membrane protein PEX13 (PEX13), recombinant protein. |
Recombinant Pichia pastoris PEX13 Protein (aa 252-380) |
VAng-Cr6649-500gEcoli |
Creative Biolabs |
500 µg (E. coli) |
EUR 2429 |
Description: Pichia pastoris Peroxisomal membrane protein PEX13 (PEX13), recombinant protein. |
Recombinant Schizosaccharomyces Pombe pex13 Protein (aa 1-288) |
VAng-Yyj5741-inquire |
Creative Biolabs |
inquire |
Ask for price |
Description: Schizosaccharomyces Pombe (strain 972 / ATCC 24843) (Fission yeast) Peroxisomal membrane protein pex13 (pex13), recombinant protein. |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PEX13 Rabbit Polyclonal Antibody