PGK2 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
PGK2 Polyclonal Antibody |
ABP59889-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of PGK2 from Human, Mouse. This PGK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160 |
PGK2 Polyclonal Antibody |
ABP59889-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of PGK2 from Human, Mouse. This PGK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160 |
PGK2 Polyclonal Antibody |
ABP59889-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160
- Applications tips:
|
Description: A polyclonal antibody for detection of PGK2 from Human, Mouse. This PGK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PGK2 protein at amino acid sequence of 80-160 |
PGK2 Polyclonal Antibody |
ES9999-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PGK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PGK2 Polyclonal Antibody |
ES9999-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PGK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PGK2 Rabbit pAb |
A12952-100ul |
Abclonal |
100 ul |
EUR 308 |
PGK2 Rabbit pAb |
A12952-200ul |
Abclonal |
200 ul |
EUR 459 |
PGK2 Rabbit pAb |
A12952-20ul |
Abclonal |
20 ul |
EUR 183 |
PGK2 Rabbit pAb |
A12952-50ul |
Abclonal |
50 ul |
EUR 223 |
PGK2 Rabbit pAb |
A4017-100ul |
Abclonal |
100 ul |
EUR 308 |
PGK2 Rabbit pAb |
A4017-200ul |
Abclonal |
200 ul |
EUR 459 |
PGK2 Rabbit pAb |
A4017-20ul |
Abclonal |
20 ul |
Ask for price |
PGK2 Rabbit pAb |
A4017-50ul |
Abclonal |
50 ul |
Ask for price |
PGK2 antibody |
70R-19242 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PGK2 antibody |
PGK2 antibody |
70R-2323 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PGK2 antibody raised against the C terminal of PGK2 |
PGK2 Antibody |
36193-100ul |
SAB |
100ul |
EUR 252 |
PGK2 Antibody |
1-CSB-PA145596 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200 |
PGK2 Antibody |
1-CSB-PA017859GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PGK2 Antibody |
1-CSB-PA017859LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000 |
PGK2 Antibody |
1-CSB-PA191316 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200 |
Polyclonal PGK2 Antibody (N-term) |
APR09089G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PGK2 (N-term). This antibody is tested and proven to work in the following applications: |
PGK2 Polyclonal Antibody, Biotin Conjugated |
A60251 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
PGK2 Polyclonal Antibody, FITC Conjugated |
A60252 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PGK2 Polyclonal Antibody, HRP Conjugated |
A60253 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Human PGK2 Antibody |
32645-05111 |
AssayPro |
150 ug |
EUR 261 |
PGK2 Conjugated Antibody |
C36193 |
SAB |
100ul |
EUR 397 |
anti- PGK2 antibody |
FNab06355 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: phosphoglycerate kinase 2
- Uniprot ID: P07205
- Gene ID: 5232
- Research Area: Metabolism
|
Description: Antibody raised against PGK2 |
Anti-PGK2 antibody |
STJ26532 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis. |
Anti-PGK2 antibody |
STJ114818 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis. |
Anti-PGK2 antibody |
STJ191157 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PGK2 |
PGK2 siRNA |
20-abx928366 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PGK2 siRNA |
20-abx928367 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-PGK2 |
YF-PA24360 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to PGK2 |
PGK2 Antibody, HRP conjugated |
1-CSB-PA017859LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PGK2 Antibody, FITC conjugated |
1-CSB-PA017859LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PGK2 Antibody, Biotin conjugated |
1-CSB-PA017859LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PGK2. Recognizes PGK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Rabbit Phosphoglycee kinase 2(PGK2) ELISA kit |
E04P0843-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Phosphoglycee kinase 2(PGK2) ELISA kit |
E04P0843-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Phosphoglycee kinase 2(PGK2) ELISA kit |
E04P0843-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
PGK2 Blocking Peptide |
33R-4189 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PGK2 antibody, catalog no. 70R-2323 |
PGK2, human recombinant |
7820-50 |
Biovision |
|
EUR 501 |
PGK2 cloning plasmid |
CSB-CL017859HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1254
- Sequence: atgtctctttctaagaagttgactttagacaaactggatgttagagggaagcgagtcatcatgagagtagacttcaatgttcccatgaagaagaaccagattacaaacaaccagaggatcaaggcttccatcccaagcatcaagtactgcctggacaatggagccaaggcagtag
- Show more
|
Description: A cloning plasmid for the PGK2 gene. |
Human PGK2 Antibody (Biotin Conjugate) |
32645-05121 |
AssayPro |
150 ug |
EUR 369 |
Phosphoglycerate Kinase 2 (PGK2) Antibody |
20-abx002947 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphoglycerate Kinase 2 (PGK2) Antibody |
20-abx114469 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphoglycerate Kinase 2 (PGK2) Antibody |
abx146476-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Phosphoglycerate Kinase 2 (PGK2) Antibody |
abx033208-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Phosphoglycerate Kinase 2 (PGK2) Antibody |
abx033208-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Phosphoglycerate Kinase 2 (PGK2) Antibody |
20-abx241045 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphoglycerate Kinase 2 (PGK2) Antibody |
20-abx241046 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphoglycerate Kinase 2 (PGK2) Antibody |
abx236355-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Phosphoglycerate Kinase 2 (PGK2) Antibody |
20-abx302642 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human PGK2 AssayLite Antibody (FITC Conjugate) |
32645-05141 |
AssayPro |
150 ug |
EUR 428 |
Human PGK2 AssayLite Antibody (RPE Conjugate) |
32645-05151 |
AssayPro |
150 ug |
EUR 428 |
Human PGK2 AssayLite Antibody (APC Conjugate) |
32645-05161 |
AssayPro |
150 ug |
EUR 428 |
Human PGK2 AssayLite Antibody (PerCP Conjugate) |
32645-05171 |
AssayPro |
150 ug |
EUR 471 |
Phosphoglycerate Kinase 2 (PGK2) Antibody (HRP) |
20-abx304803 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phosphoglycerate Kinase 2 (PGK2) Antibody (FITC) |
20-abx304804 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phosphoglycerate Kinase 2 (PGK2) Antibody (Biotin) |
20-abx304805 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PGK2 protein (His tag) |
80R-2091 |
Fitzgerald |
50 ug |
EUR 424 |
Description: Recombinant human PGK2 protein (His tag) |
Mouse PGK2 shRNA Plasmid |
20-abx972018 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PGK2 shRNA Plasmid |
20-abx953496 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PGK2 Recombinant Protein (Human) |
RP023230 |
ABM |
100 ug |
Ask for price |
PGK2 Recombinant Protein (Mouse) |
RP161579 |
ABM |
100 ug |
Ask for price |
PGK2 Recombinant Protein (Rat) |
RP220214 |
ABM |
100 ug |
Ask for price |
Pgk2 ORF Vector (Rat) (pORF) |
ORF073406 |
ABM |
1.0 ug DNA |
EUR 506 |
PGK2 ORF Vector (Human) (pORF) |
ORF007744 |
ABM |
1.0 ug DNA |
EUR 95 |
Pgk2 ORF Vector (Mouse) (pORF) |
ORF053861 |
ABM |
1.0 ug DNA |
EUR 506 |
Pgk2 sgRNA CRISPR Lentivector set (Rat) |
K6046401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pgk2 sgRNA CRISPR Lentivector set (Mouse) |
K3822201 |
ABM |
3 x 1.0 ug |
EUR 339 |
PGK2 sgRNA CRISPR Lentivector set (Human) |
K1635001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rat Phosphoglycee kinase 2(PGK2) ELISA kit |
E02P0843-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phosphoglycee kinase 2(PGK2) ELISA kit |
E02P0843-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Phosphoglycee kinase 2(PGK2) ELISA kit |
E02P0843-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Phosphoglycee kinase 2(PGK2) ELISA kit |
E03P0843-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Phosphoglycee kinase 2(PGK2) ELISA kit |
E03P0843-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Phosphoglycee kinase 2(PGK2) ELISA kit |
E03P0843-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phosphoglycee kinase 2(PGK2) ELISA kit |
E01P0843-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phosphoglycee kinase 2(PGK2) ELISA kit |
E01P0843-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Phosphoglycee kinase 2(PGK2) ELISA kit |
E01P0843-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Phosphoglycee kinase 2(PGK2) ELISA kit |
E06P0843-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Phosphoglycee kinase 2(PGK2) ELISA kit |
E06P0843-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Phosphoglycee kinase 2(PGK2) ELISA kit |
E06P0843-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Phosphoglycee kinase 2(PGK2) ELISA kit |
E08P0843-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Phosphoglycee kinase 2(PGK2) ELISA kit |
E08P0843-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Phosphoglycee kinase 2(PGK2) ELISA kit |
E08P0843-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Phosphoglycee kinase 2(PGK2) ELISA kit |
E07P0843-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Phosphoglycee kinase 2(PGK2) ELISA kit |
E07P0843-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Phosphoglycee kinase 2(PGK2) ELISA kit |
E07P0843-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Phosphoglycee kinase 2(PGK2) ELISA kit |
E09P0843-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Phosphoglycee kinase 2(PGK2) ELISA kit |
E09P0843-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Phosphoglycee kinase 2(PGK2) ELISA kit |
E09P0843-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Phosphoglycee kinase 2(PGK2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Phosphoglycerate kinase 2, Pgk2 ELISA KIT |
ELI-15273m |
Lifescience Market |
96 Tests |
EUR 865 |
Porcine Phosphoglycerate kinase 2, PGK2 ELISA KIT |
ELI-20972p |
Lifescience Market |
96 Tests |
EUR 928 |
Human Phosphoglycerate kinase 2, PGK2 ELISA KIT |
ELI-22705h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Phosphoglycerate Kinase 2 (PGK2) ELISA Kit |
abx382179-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Pgk2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6046402 |
ABM |
1.0 ug DNA |
EUR 154 |
Pgk2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6046403 |
ABM |
1.0 ug DNA |
EUR 154 |
Pgk2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6046404 |
ABM |
1.0 ug DNA |
EUR 154 |
Pgk2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3822202 |
ABM |
1.0 ug DNA |
EUR 154 |
Pgk2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3822203 |
ABM |
1.0 ug DNA |
EUR 154 |
Pgk2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3822204 |
ABM |
1.0 ug DNA |
EUR 154 |
PGK2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1635002 |
ABM |
1.0 ug DNA |
EUR 154 |
PGK2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1635003 |
ABM |
1.0 ug DNA |
EUR 154 |
PGK2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1635004 |
ABM |
1.0 ug DNA |
EUR 154 |
PGK2 Phosphoglycerate Kinase 2 Human Recombinant Protein |
PROTP07205 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: PGK2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 437 amino acids (1-417 a.a.) and having a molecular mass of 46.9kDa.;PGK2 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques. |
PGK2 Protein Vector (Rat) (pPB-C-His) |
PV293622 |
ABM |
500 ng |
EUR 603 |
PGK2 Protein Vector (Rat) (pPB-N-His) |
PV293623 |
ABM |
500 ng |
EUR 603 |
PGK2 Protein Vector (Rat) (pPM-C-HA) |
PV293624 |
ABM |
500 ng |
EUR 603 |
PGK2 Protein Vector (Rat) (pPM-C-His) |
PV293625 |
ABM |
500 ng |
EUR 603 |
PGK2 Protein Vector (Human) (pPB-C-His) |
PV030973 |
ABM |
500 ng |
EUR 329 |
PGK2 Protein Vector (Human) (pPB-N-His) |
PV030974 |
ABM |
500 ng |
EUR 329 |
PGK2 Protein Vector (Human) (pPM-C-HA) |
PV030975 |
ABM |
500 ng |
EUR 329 |
PGK2 Protein Vector (Human) (pPM-C-His) |
PV030976 |
ABM |
500 ng |
EUR 329 |
PGK2 Protein Vector (Mouse) (pPB-C-His) |
PV215442 |
ABM |
500 ng |
EUR 603 |
PGK2 Protein Vector (Mouse) (pPB-N-His) |
PV215443 |
ABM |
500 ng |
EUR 603 |
PGK2 Protein Vector (Mouse) (pPM-C-HA) |
PV215444 |
ABM |
500 ng |
EUR 603 |
PGK2 Rabbit Polyclonal Antibody