PIGA Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
PIGA Polyclonal Antibody |
ES9989-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PIGA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PIGA Polyclonal Antibody |
ES9989-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PIGA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PIGA Rabbit pAb |
A6236-100ul |
Abclonal |
100 ul |
EUR 308 |
PIGA Rabbit pAb |
A6236-200ul |
Abclonal |
200 ul |
EUR 459 |
PIGA Rabbit pAb |
A6236-20ul |
Abclonal |
20 ul |
EUR 183 |
PIGA Rabbit pAb |
A6236-50ul |
Abclonal |
50 ul |
EUR 223 |
PIGA antibody |
70R-19281 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal PIGA antibody |
PIGA Antibody |
46125-100ul |
SAB |
100ul |
EUR 252 |
PIGA Antibody |
46125-50ul |
SAB |
50ul |
EUR 187 |
PIGA Antibody |
DF9742 |
Affbiotech |
200ul |
EUR 304 |
Description: PIGA Antibody detects endogenous levels of total PIGA. |
PIGA Antibody |
1-CSB-PA017965GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
PIGA Antibody |
1-CSB-PA017965LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
PIGA antibody |
70R-6607 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PIGA antibody raised against the middle region of PIGA |
PIGA antibody |
70R-8625 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal PIGA antibody |
Polyclonal PIGA Antibody (C-term) |
APR03682G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIGA (C-term). This antibody is tested and proven to work in the following applications: |
PIGA Conjugated Antibody |
C46125 |
SAB |
100ul |
EUR 397 |
anti- PIGA antibody |
FNab06438 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: phosphatidylinositol glycan anchor biosynthesis, class A
- Uniprot ID: P37287
- Gene ID: 5277
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against PIGA |
Anti-PIGA antibody |
STJ27992 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein required for synthesis of N-acetylglucosaminyl phosphatidylinositol (GlcNAc-PI), the first intermediate in the biosynthetic pathway of GPI anchor. The GPI anchor is a glycolipid found on many blood cells and which serves to anchor proteins to the cell surface. Paroxysmal nocturnal hemoglobinuria, an acquired hematologic disorder, has been shown to result from mutations in this gene. Alternate splice variants have been characterized. A related pseudogene is located on chromosome 12. |
Anti-PIGA antibody |
STJ191147 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PIGA |
PIGA siRNA |
20-abx928557 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGA siRNA |
20-abx928558 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGA Antibody, HRP conjugated |
1-CSB-PA017965LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PIGA Antibody, FITC conjugated |
1-CSB-PA017965LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PIGA Antibody, Biotin conjugated |
1-CSB-PA017965LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGA. Recognizes PIGA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PIGA Blocking Peptide |
33R-8916 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGA antibody, catalog no. 70R-6607 |
PIGA Blocking Peptide |
DF9742-BP |
Affbiotech |
1mg |
EUR 195 |
PIGA cloning plasmid |
CSB-CL017965HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1455
- Sequence: atggcctgtagaggaggagctgggaatggccaccgtgcctcagctacactctctcgggttagccctggaagtctttacacatgtagaacccgtacccataatatatgcatggtatctgactttttctacccaaatatgggaggcgtggaaagccacatttaccagctctctcagt
- Show more
|
Description: A cloning plasmid for the PIGA gene. |
Mouse PIGA shRNA Plasmid |
20-abx972029 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PIGA shRNA Plasmid |
20-abx953526 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PIGA Recombinant Protein (Human) |
RP023434 |
ABM |
100 ug |
Ask for price |
PIGA Recombinant Protein (Mouse) |
RP162014 |
ABM |
100 ug |
Ask for price |
PIGA Recombinant Protein (Rat) |
RP220463 |
ABM |
100 ug |
Ask for price |
Piga ORF Vector (Rat) (pORF) |
ORF073489 |
ABM |
1.0 ug DNA |
EUR 506 |
PIGA ORF Vector (Human) (pORF) |
ORF007812 |
ABM |
1.0 ug DNA |
EUR 95 |
Piga ORF Vector (Mouse) (pORF) |
ORF054006 |
ABM |
1.0 ug DNA |
EUR 506 |
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
abx026766-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
abx026766-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
20-abx006618 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
20-abx217763 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (Piga) Antibody |
20-abx114440 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
abx236438-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody |
20-abx333889 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Piga sgRNA CRISPR Lentivector set (Mouse) |
K4985401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Piga sgRNA CRISPR Lentivector set (Rat) |
K6656901 |
ABM |
3 x 1.0 ug |
EUR 339 |
PIGA sgRNA CRISPR Lentivector set (Human) |
K1646601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (HRP) |
20-abx337009 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (FITC) |
20-abx337010 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class A (PIGA) Antibody (Biotin) |
20-abx337011 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Piga sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4985402 |
ABM |
1.0 ug DNA |
EUR 154 |
Piga sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4985403 |
ABM |
1.0 ug DNA |
EUR 154 |
Piga sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4985404 |
ABM |
1.0 ug DNA |
EUR 154 |
Piga sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6656902 |
ABM |
1.0 ug DNA |
EUR 154 |
Piga sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6656903 |
ABM |
1.0 ug DNA |
EUR 154 |
Piga sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6656904 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGA sgRNA CRISPR Lentivector (Human) (Target 1) |
K1646602 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGA sgRNA CRISPR Lentivector (Human) (Target 2) |
K1646603 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGA sgRNA CRISPR Lentivector (Human) (Target 3) |
K1646604 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGA Protein Vector (Rat) (pPB-C-His) |
PV293954 |
ABM |
500 ng |
EUR 603 |
PIGA Protein Vector (Rat) (pPB-N-His) |
PV293955 |
ABM |
500 ng |
EUR 603 |
PIGA Protein Vector (Rat) (pPM-C-HA) |
PV293956 |
ABM |
500 ng |
EUR 603 |
PIGA Protein Vector (Rat) (pPM-C-His) |
PV293957 |
ABM |
500 ng |
EUR 603 |
PIGA Protein Vector (Human) (pPB-C-His) |
PV031245 |
ABM |
500 ng |
EUR 329 |
PIGA Protein Vector (Human) (pPB-N-His) |
PV031246 |
ABM |
500 ng |
EUR 329 |
PIGA Protein Vector (Human) (pPM-C-HA) |
PV031247 |
ABM |
500 ng |
EUR 329 |
PIGA Protein Vector (Human) (pPM-C-His) |
PV031248 |
ABM |
500 ng |
EUR 329 |
PIGA Protein Vector (Mouse) (pPB-C-His) |
PV216022 |
ABM |
500 ng |
EUR 603 |
PIGA Protein Vector (Mouse) (pPB-N-His) |
PV216023 |
ABM |
500 ng |
EUR 603 |
PIGA Protein Vector (Mouse) (pPM-C-HA) |
PV216024 |
ABM |
500 ng |
EUR 603 |
PIGA Protein Vector (Mouse) (pPM-C-His) |
PV216025 |
ABM |
500 ng |
EUR 603 |
Piga 3'UTR Luciferase Stable Cell Line |
TU116345 |
ABM |
1.0 ml |
Ask for price |
Piga 3'UTR GFP Stable Cell Line |
TU166345 |
ABM |
1.0 ml |
Ask for price |
Piga 3'UTR Luciferase Stable Cell Line |
TU216224 |
ABM |
1.0 ml |
Ask for price |
Piga 3'UTR GFP Stable Cell Line |
TU266224 |
ABM |
1.0 ml |
Ask for price |
PIGA 3'UTR GFP Stable Cell Line |
TU067926 |
ABM |
1.0 ml |
EUR 4617 |
PIGA 3'UTR Luciferase Stable Cell Line |
TU017926 |
ABM |
1.0 ml |
EUR 4617 |
PIGA Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV622225 |
ABM |
1.0 ug DNA |
EUR 514 |
PIGA Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV622229 |
ABM |
1.0 ug DNA |
EUR 514 |
PIGA Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV622230 |
ABM |
1.0 ug DNA |
EUR 514 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
PIGA Rabbit Polyclonal Antibody