PIGP Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
PIGP Polyclonal Antibody |
ES9991-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PIGP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PIGP Polyclonal Antibody |
ABP59912-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of PIGP from Human, Mouse. This PIGP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150 |
PIGP Polyclonal Antibody |
ABP59912-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of PIGP from Human, Mouse. This PIGP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150 |
PIGP Polyclonal Antibody |
ABP59912-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of PIGP from Human, Mouse. This PIGP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150 |
PIGP Rabbit pAb |
A15446-100ul |
Abclonal |
100 ul |
EUR 308 |
PIGP Rabbit pAb |
A15446-200ul |
Abclonal |
200 ul |
EUR 459 |
PIGP Rabbit pAb |
A15446-20ul |
Abclonal |
20 ul |
EUR 183 |
PIGP Rabbit pAb |
A15446-50ul |
Abclonal |
50 ul |
EUR 223 |
PIGP Antibody |
46127-100ul |
SAB |
100ul |
EUR 252 |
PIGP Antibody |
46127-50ul |
SAB |
50ul |
EUR 187 |
PIGP Antibody |
DF9744 |
Affbiotech |
200ul |
EUR 304 |
Description: PIGP Antibody detects endogenous levels of total PIGP. |
PIGP Antibody |
1-CSB-PA017979LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
PIGP Conjugated Antibody |
C46127 |
SAB |
100ul |
EUR 397 |
anti- PIGP antibody |
FNab06444 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: phosphatidylinositol glycan anchor biosynthesis, class P
- Uniprot ID: P57054
- Gene ID: 51227
- Research Area: Metabolism
|
Description: Antibody raised against PIGP |
Anti-PIGP antibody |
STJ117641 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-PIGP antibody |
STJ191149 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PIGP |
PIGP siRNA |
20-abx928576 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGP siRNA |
20-abx928577 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGP Antibody, HRP conjugated |
1-CSB-PA017979LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PIGP Antibody, FITC conjugated |
1-CSB-PA017979LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PIGP Antibody, Biotin conjugated |
1-CSB-PA017979LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PIGP cloning plasmid |
CSB-CL017979HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 405
- Sequence: atggtggaaaattcaccgtcgccattgccagaaagagcgatttatggctttgttcttttcttaagctcccaatttggcttcatactttacctcgtgtgggcctttattcctgaatcttggctaaactctttaggtttaacctattggcctcaaaaatattgggcagttgcattacc
- Show more
|
Description: A cloning plasmid for the PIGP gene. |
PIGP Blocking Peptide |
DF9744-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-PIGP (2E7) |
YF-MA18446 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PIGP |
Mouse PIGP shRNA Plasmid |
20-abx974629 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human PIGP shRNA Plasmid |
20-abx959618 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PIGP Recombinant Protein (Human) |
RP023473 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Rat) |
RP220487 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
RP162053 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
RP162056 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
RP162059 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
RP162062 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
RP162065 |
ABM |
100 ug |
Ask for price |
PIGP Recombinant Protein (Mouse) |
RP162068 |
ABM |
100 ug |
Ask for price |
PIGP ORF Vector (Human) (pORF) |
ORF007825 |
ABM |
1.0 ug DNA |
EUR 95 |
Pigp ORF Vector (Rat) (pORF) |
ORF073497 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
ORF054019 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
ORF054020 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
ORF054021 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
ORF054022 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
ORF054023 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigp ORF Vector (Mouse) (pORF) |
ORF054024 |
ABM |
1.0 ug DNA |
EUR 506 |
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody |
abx029081-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody |
abx029081-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody |
20-abx217767 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody |
abx236444-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody |
20-abx302113 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PIGP sgRNA CRISPR Lentivector set (Human) |
K1648001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pigp sgRNA CRISPR Lentivector set (Mouse) |
K3106601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pigp sgRNA CRISPR Lentivector set (Rat) |
K6548601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (HRP) |
20-abx314272 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (FITC) |
20-abx314273 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (Biotin) |
20-abx314274 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PIGP sgRNA CRISPR Lentivector (Human) (Target 1) |
K1648002 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGP sgRNA CRISPR Lentivector (Human) (Target 2) |
K1648003 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGP sgRNA CRISPR Lentivector (Human) (Target 3) |
K1648004 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigp sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3106602 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigp sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3106603 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigp sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3106604 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigp sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6548602 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigp sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6548603 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigp sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6548604 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGP Protein Vector (Human) (pPB-C-His) |
PV031297 |
ABM |
500 ng |
EUR 329 |
PIGP Protein Vector (Human) (pPB-N-His) |
PV031298 |
ABM |
500 ng |
EUR 329 |
PIGP Protein Vector (Human) (pPM-C-HA) |
PV031299 |
ABM |
500 ng |
EUR 329 |
PIGP Protein Vector (Human) (pPM-C-His) |
PV031300 |
ABM |
500 ng |
EUR 329 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
PV216074 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
PV216075 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
PV216076 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
PV216077 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
PV216078 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
PV216079 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
PV216080 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
PV216081 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
PV216082 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
PV216083 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
PV216084 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
PV216085 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
PV216086 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
PV216087 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
PV216088 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
PV216089 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
PV216090 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
PV216091 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
PV216092 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
PV216093 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-C-His) |
PV216094 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPB-N-His) |
PV216095 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-HA) |
PV216096 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Mouse) (pPM-C-His) |
PV216097 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Rat) (pPB-C-His) |
PV293986 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Rat) (pPB-N-His) |
PV293987 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Rat) (pPM-C-HA) |
PV293988 |
ABM |
500 ng |
EUR 603 |
PIGP Protein Vector (Rat) (pPM-C-His) |
PV293989 |
ABM |
500 ng |
EUR 603 |
Pigp 3'UTR GFP Stable Cell Line |
TU166356 |
ABM |
1.0 ml |
Ask for price |
PIGP 3'UTR Luciferase Stable Cell Line |
TU017940 |
ABM |
1.0 ml |
EUR 1521 |
Pigp 3'UTR Luciferase Stable Cell Line |
TU116356 |
ABM |
1.0 ml |
Ask for price |
PIGP 3'UTR GFP Stable Cell Line |
TU067940 |
ABM |
1.0 ml |
EUR 1521 |
Pigp 3'UTR GFP Stable Cell Line |
TU266234 |
ABM |
1.0 ml |
Ask for price |
Pigp 3'UTR Luciferase Stable Cell Line |
TU216234 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PIGP Rabbit Polyclonal Antibody