PIGP Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PIGP Polyclonal Antibody
ES9991-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PIGP from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGP Polyclonal Antibody
ABP59912-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150 Applications tips:
Description: A polyclonal antibody for detection of PIGP from Human, Mouse. This PIGP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150

PIGP Polyclonal Antibody
ABP59912-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150 Applications tips:
Description: A polyclonal antibody for detection of PIGP from Human, Mouse. This PIGP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150

PIGP Polyclonal Antibody
ABP59912-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150 Applications tips:
Description: A polyclonal antibody for detection of PIGP from Human, Mouse. This PIGP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGP protein at amino acid sequence of 70-150

PIGP Rabbit pAb
A15446-100ul	Abclonal	100 ul	EUR 308

PIGP Rabbit pAb
A15446-200ul	Abclonal	200 ul	EUR 459

PIGP Rabbit pAb
A15446-20ul	Abclonal	20 ul	EUR 183

PIGP Rabbit pAb
A15446-50ul	Abclonal	50 ul	EUR 223

PIGP Antibody
ABD9744	Lifescience Market	100 ug	EUR 438

PIGP Antibody
46127-100ul	SAB	100ul	EUR 252

PIGP Antibody
46127-50ul	SAB	50ul	EUR 187

PIGP Antibody
DF9744	Affbiotech	200ul	EUR 304
Description: PIGP Antibody detects endogenous levels of total PIGP.

PIGP Antibody
1-CSB-PA017979LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

PIGP Conjugated Antibody
C46127	SAB	100ul	EUR 397

anti- PIGP antibody
FNab06444	FN Test	100µg	EUR 548.75
Immunogen: phosphatidylinositol glycan anchor biosynthesis, class P Uniprot ID: P57054 Gene ID: 51227 Research Area: Metabolism
Description: Antibody raised against PIGP

Anti-PIGP antibody
PAab06444	Lifescience Market	100 ug	EUR 386

Anti-PIGP antibody
STJ117641	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-PIGP antibody
STJ191149	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PIGP

PIGP siRNA
20-abx928576	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIGP siRNA
20-abx928577	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIGP Antibody, HRP conjugated
1-CSB-PA017979LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGP Antibody, FITC conjugated
1-CSB-PA017979LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGP Antibody, Biotin conjugated
1-CSB-PA017979LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGP. Recognizes PIGP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGP cloning plasmid
CSB-CL017979HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 405 Sequence: atggtggaaaattcaccgtcgccattgccagaaagagcgatttatggctttgttcttttcttaagctcccaatttggcttcatactttacctcgtgtgggcctttattcctgaatcttggctaaactctttaggtttaacctattggcctcaaaaatattgggcagttgcattacc Show more
Description: A cloning plasmid for the PIGP gene.

PIGP Blocking Peptide
DF9744-BP	Affbiotech	1mg	EUR 195

Anti-PIGP (2E7)
YF-MA18446	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PIGP

Mouse PIGP shRNA Plasmid
20-abx974629	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Pigp ELISA KIT
ELI-22729m	Lifescience Market	96 Tests	EUR 865

PIGP ELISA KIT|Human
EF001781	Lifescience Market	96 Tests	EUR 689

Human PIGP ELISA KIT
ELI-43654h	Lifescience Market	96 Tests	EUR 824

Human PIGP shRNA Plasmid
20-abx959618	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PIGP Recombinant Protein (Human)
RP023473	ABM	100 ug	Ask for price

PIGP Recombinant Protein (Rat)
RP220487	ABM	100 ug	Ask for price

PIGP Recombinant Protein (Mouse)
RP162053	ABM	100 ug	Ask for price

PIGP Recombinant Protein (Mouse)
RP162056	ABM	100 ug	Ask for price

PIGP Recombinant Protein (Mouse)
RP162059	ABM	100 ug	Ask for price

PIGP Recombinant Protein (Mouse)
RP162062	ABM	100 ug	Ask for price

PIGP Recombinant Protein (Mouse)
RP162065	ABM	100 ug	Ask for price

PIGP Recombinant Protein (Mouse)
RP162068	ABM	100 ug	Ask for price

PIGP ORF Vector (Human) (pORF)
ORF007825	ABM	1.0 ug DNA	EUR 95

Pigp ORF Vector (Rat) (pORF)
ORF073497	ABM	1.0 ug DNA	EUR 506

Pigp ORF Vector (Mouse) (pORF)
ORF054019	ABM	1.0 ug DNA	EUR 506

Pigp ORF Vector (Mouse) (pORF)
ORF054020	ABM	1.0 ug DNA	EUR 506

Pigp ORF Vector (Mouse) (pORF)
ORF054021	ABM	1.0 ug DNA	EUR 506

Pigp ORF Vector (Mouse) (pORF)
ORF054022	ABM	1.0 ug DNA	EUR 506

Pigp ORF Vector (Mouse) (pORF)
ORF054023	ABM	1.0 ug DNA	EUR 506

Pigp ORF Vector (Mouse) (pORF)
ORF054024	ABM	1.0 ug DNA	EUR 506

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
abx029081-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
abx029081-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
20-abx217767	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
abx236444-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody
20-abx302113	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PIGP sgRNA CRISPR Lentivector set (Human)
K1648001	ABM	3 x 1.0 ug	EUR 339

Pigp sgRNA CRISPR Lentivector set (Mouse)
K3106601	ABM	3 x 1.0 ug	EUR 339

Pigp sgRNA CRISPR Lentivector set (Rat)
K6548601	ABM	3 x 1.0 ug	EUR 339

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (HRP)
20-abx314272	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (FITC)
20-abx314273	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phosphatidylinositol Glycan Anchor Biosynthesis Class P (PIGP) Antibody (Biotin)
20-abx314274	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PIGP sgRNA CRISPR Lentivector (Human) (Target 1)
K1648002	ABM	1.0 ug DNA	EUR 154

PIGP sgRNA CRISPR Lentivector (Human) (Target 2)
K1648003	ABM	1.0 ug DNA	EUR 154

PIGP sgRNA CRISPR Lentivector (Human) (Target 3)
K1648004	ABM	1.0 ug DNA	EUR 154

Pigp sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3106602	ABM	1.0 ug DNA	EUR 154

Pigp sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3106603	ABM	1.0 ug DNA	EUR 154

Pigp sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3106604	ABM	1.0 ug DNA	EUR 154

Pigp sgRNA CRISPR Lentivector (Rat) (Target 1)
K6548602	ABM	1.0 ug DNA	EUR 154

Pigp sgRNA CRISPR Lentivector (Rat) (Target 2)
K6548603	ABM	1.0 ug DNA	EUR 154

Pigp sgRNA CRISPR Lentivector (Rat) (Target 3)
K6548604	ABM	1.0 ug DNA	EUR 154

PIGP Protein Vector (Human) (pPB-C-His)
PV031297	ABM	500 ng	EUR 329

PIGP Protein Vector (Human) (pPB-N-His)
PV031298	ABM	500 ng	EUR 329

PIGP Protein Vector (Human) (pPM-C-HA)
PV031299	ABM	500 ng	EUR 329

PIGP Protein Vector (Human) (pPM-C-His)
PV031300	ABM	500 ng	EUR 329

PIGP Protein Vector (Mouse) (pPB-C-His)
PV216074	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)
PV216075	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216076	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)
PV216077	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-C-His)
PV216078	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)
PV216079	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216080	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)
PV216081	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-C-His)
PV216082	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)
PV216083	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216084	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)
PV216085	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-C-His)
PV216086	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)
PV216087	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216088	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)
PV216089	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-C-His)
PV216090	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)
PV216091	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216092	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)
PV216093	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-C-His)
PV216094	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPB-N-His)
PV216095	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-HA)
PV216096	ABM	500 ng	EUR 603

PIGP Protein Vector (Mouse) (pPM-C-His)
PV216097	ABM	500 ng	EUR 603

PIGP Protein Vector (Rat) (pPB-C-His)
PV293986	ABM	500 ng	EUR 603

PIGP Protein Vector (Rat) (pPB-N-His)
PV293987	ABM	500 ng	EUR 603

PIGP Protein Vector (Rat) (pPM-C-HA)
PV293988	ABM	500 ng	EUR 603

PIGP Protein Vector (Rat) (pPM-C-His)
PV293989	ABM	500 ng	EUR 603

Pigp 3'UTR GFP Stable Cell Line
TU166356	ABM	1.0 ml	Ask for price

PIGP 3'UTR Luciferase Stable Cell Line
TU017940	ABM	1.0 ml	EUR 1521

Pigp 3'UTR Luciferase Stable Cell Line
TU116356	ABM	1.0 ml	Ask for price

PIGP 3'UTR GFP Stable Cell Line
TU067940	ABM	1.0 ml	EUR 1521

Pigp 3'UTR GFP Stable Cell Line
TU266234	ABM	1.0 ml	Ask for price

Pigp 3'UTR Luciferase Stable Cell Line
TU216234	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PIGP Rabbit Polyclonal Antibody