PIGQ Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
PIGQ Polyclonal Antibody |
ABP59913-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human PIGQ protein at amino acid sequence of 130-210
- Applications tips:
|
Description: A polyclonal antibody for detection of PIGQ from Human, Mouse. This PIGQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGQ protein at amino acid sequence of 130-210 |
PIGQ Polyclonal Antibody |
ES9992-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against PIGQ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PIGQ Polyclonal Antibody |
ES9992-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against PIGQ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
PIGQ Rabbit pAb |
A17044-100ul |
Abclonal |
100 ul |
EUR 308 |
PIGQ Rabbit pAb |
A17044-200ul |
Abclonal |
200 ul |
EUR 459 |
PIGQ Rabbit pAb |
A17044-20ul |
Abclonal |
20 ul |
EUR 183 |
PIGQ Rabbit pAb |
A17044-50ul |
Abclonal |
50 ul |
EUR 223 |
PIGQ Antibody |
46128-100ul |
SAB |
100ul |
EUR 252 |
PIGQ Antibody |
46128-50ul |
SAB |
50ul |
EUR 187 |
PIGQ Antibody |
1-CSB-PA883583LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200 |
PIGQ Antibody |
DF9745 |
Affbiotech |
200ul |
EUR 304 |
Description: PIGQ Antibody detects endogenous levels of total PIGQ. |
PIGQ antibody |
70R-6645 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PIGQ antibody raised against the N terminal of PIGQ |
PIGQ antibody |
70R-6647 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal PIGQ antibody raised against the N terminal of PIGQ |
PIGQ Conjugated Antibody |
C46128 |
SAB |
100ul |
EUR 397 |
Anti-PIGQ antibody |
STJ191150 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to PIGQ |
PIGQ siRNA |
20-abx928578 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGQ siRNA |
20-abx928579 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
PIGQ Antibody, HRP conjugated |
1-CSB-PA883583LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
PIGQ Antibody, FITC conjugated |
1-CSB-PA883583LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
PIGQ Antibody, Biotin conjugated |
1-CSB-PA883583LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
PIGQ Blocking Peptide |
33R-9665 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGQ antibody, catalog no. 70R-6645 |
PIGQ Blocking Peptide |
33R-7400 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGQ antibody, catalog no. 70R-6647 |
PIGQ Blocking Peptide |
DF9745-BP |
Affbiotech |
1mg |
EUR 195 |
PIGQ cloning plasmid |
CSB-CL883583HU-10ug |
Cusabio |
10ug |
EUR 749 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2283
- Sequence: atggtgctcaaggccttcttccccacgtgctgcgtctcgacggacagcgggctgctggtgggacggtgggtgccggagcagagcagcgccgtggtcctggcggtcctgcactttcccttcatccccatccaggtcaagcagctcctggcccaggtgcggcaggccagccaggtgg
- Show more
|
Description: A cloning plasmid for the PIGQ gene. |
Anti-PIGQ (2B7) |
YF-MA16652 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to PIGQ |
Human PIGQ shRNA Plasmid |
20-abx956004 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse PIGQ shRNA Plasmid |
20-abx970628 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PIGQ Recombinant Protein (Human) |
RP023476 |
ABM |
100 ug |
Ask for price |
PIGQ Recombinant Protein (Mouse) |
RP162071 |
ABM |
100 ug |
Ask for price |
PIGQ Recombinant Protein (Rat) |
RP220490 |
ABM |
100 ug |
Ask for price |
Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit Q (PIGQ) Antibody |
20-abx217768 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Pigq ORF Vector (Rat) (pORF) |
ORF073498 |
ABM |
1.0 ug DNA |
EUR 506 |
PIGQ ORF Vector (Human) (pORF) |
ORF007826 |
ABM |
1.0 ug DNA |
EUR 95 |
Pigq ORF Vector (Mouse) (pORF) |
ORF054025 |
ABM |
1.0 ug DNA |
EUR 506 |
Pigq sgRNA CRISPR Lentivector set (Mouse) |
K4911601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pigq sgRNA CRISPR Lentivector set (Rat) |
K7371601 |
ABM |
3 x 1.0 ug |
EUR 339 |
PIGQ sgRNA CRISPR Lentivector set (Human) |
K1648101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Pigq sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4911602 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4911603 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4911604 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7371602 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7371603 |
ABM |
1.0 ug DNA |
EUR 154 |
Pigq sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7371604 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGQ sgRNA CRISPR Lentivector (Human) (Target 1) |
K1648102 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGQ sgRNA CRISPR Lentivector (Human) (Target 2) |
K1648103 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGQ sgRNA CRISPR Lentivector (Human) (Target 3) |
K1648104 |
ABM |
1.0 ug DNA |
EUR 154 |
PIGQ Protein Vector (Rat) (pPB-C-His) |
PV293990 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Rat) (pPB-N-His) |
PV293991 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Rat) (pPM-C-HA) |
PV293992 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Rat) (pPM-C-His) |
PV293993 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Human) (pPB-C-His) |
PV031301 |
ABM |
500 ng |
EUR 329 |
PIGQ Protein Vector (Human) (pPB-N-His) |
PV031302 |
ABM |
500 ng |
EUR 329 |
PIGQ Protein Vector (Human) (pPM-C-HA) |
PV031303 |
ABM |
500 ng |
EUR 329 |
PIGQ Protein Vector (Human) (pPM-C-His) |
PV031304 |
ABM |
500 ng |
EUR 329 |
PIGQ Protein Vector (Mouse) (pPB-C-His) |
PV216098 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Mouse) (pPB-N-His) |
PV216099 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Mouse) (pPM-C-HA) |
PV216100 |
ABM |
500 ng |
EUR 603 |
PIGQ Protein Vector (Mouse) (pPM-C-His) |
PV216101 |
ABM |
500 ng |
EUR 603 |
Pigq 3'UTR Luciferase Stable Cell Line |
TU116357 |
ABM |
1.0 ml |
Ask for price |
Pigq 3'UTR GFP Stable Cell Line |
TU166357 |
ABM |
1.0 ml |
Ask for price |
Pigq 3'UTR Luciferase Stable Cell Line |
TU216235 |
ABM |
1.0 ml |
Ask for price |
Pigq 3'UTR GFP Stable Cell Line |
TU266235 |
ABM |
1.0 ml |
Ask for price |
PIGQ 3'UTR GFP Stable Cell Line |
TU067941 |
ABM |
1.0 ml |
EUR 1394 |
PIGQ 3'UTR Luciferase Stable Cell Line |
TU017941 |
ABM |
1.0 ml |
EUR 1394 |
PIGQ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV634447 |
ABM |
1.0 ug DNA |
EUR 682 |
PIGQ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV634451 |
ABM |
1.0 ug DNA |
EUR 682 |
PIGQ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV634452 |
ABM |
1.0 ug DNA |
EUR 682 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
PIGQ Rabbit Polyclonal Antibody