PIGQ Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

PIGQ Polyclonal Antibody
ABP59913-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PIGQ protein at amino acid sequence of 130-210 Applications tips:
Description: A polyclonal antibody for detection of PIGQ from Human, Mouse. This PIGQ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PIGQ protein at amino acid sequence of 130-210

PIGQ Polyclonal Antibody
ES9992-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PIGQ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGQ Polyclonal Antibody
ES9992-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PIGQ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PIGQ Rabbit pAb
A17044-100ul	Abclonal	100 ul	EUR 308

PIGQ Rabbit pAb
A17044-200ul	Abclonal	200 ul	EUR 459

PIGQ Rabbit pAb
A17044-20ul	Abclonal	20 ul	EUR 183

PIGQ Rabbit pAb
A17044-50ul	Abclonal	50 ul	EUR 223

PIGQ Antibody
46128-100ul	SAB	100ul	EUR 252

PIGQ Antibody
46128-50ul	SAB	50ul	EUR 187

PIGQ Antibody
1-CSB-PA883583LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

PIGQ Antibody
DF9745	Affbiotech	200ul	EUR 304
Description: PIGQ Antibody detects endogenous levels of total PIGQ.

PIGQ antibody
70R-6645	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PIGQ antibody raised against the N terminal of PIGQ

PIGQ antibody
70R-6647	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PIGQ antibody raised against the N terminal of PIGQ

PIGQ Antibody
ABD9745	Lifescience Market	100 ug	EUR 438

PIGQ Conjugated Antibody
C46128	SAB	100ul	EUR 397

Anti-PIGQ antibody
STJ119318	St John's Laboratory	100 µl	EUR 277

Anti-PIGQ antibody
STJ191150	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PIGQ

PIGQ siRNA
20-abx928578	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIGQ siRNA
20-abx928579	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PIGQ Antibody, HRP conjugated
1-CSB-PA883583LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PIGQ Antibody, FITC conjugated
1-CSB-PA883583LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PIGQ Antibody, Biotin conjugated
1-CSB-PA883583LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PIGQ. Recognizes PIGQ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PIGQ Blocking Peptide
33R-9665	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGQ antibody, catalog no. 70R-6645

PIGQ Blocking Peptide
33R-7400	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PIGQ antibody, catalog no. 70R-6647

PIGQ Blocking Peptide
DF9745-BP	Affbiotech	1mg	EUR 195

PIGQ cloning plasmid
CSB-CL883583HU-10ug	Cusabio	10ug	EUR 749
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2283 Sequence: atggtgctcaaggccttcttccccacgtgctgcgtctcgacggacagcgggctgctggtgggacggtgggtgccggagcagagcagcgccgtggtcctggcggtcctgcactttcccttcatccccatccaggtcaagcagctcctggcccaggtgcggcaggccagccaggtgg Show more
Description: A cloning plasmid for the PIGQ gene.

pENTR223-PIGQ vector
PVT11790	Lifescience Market	2 ug	EUR 304

Anti-PIGQ (2B7)
YF-MA16652	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PIGQ

Human PIGQ ELISA KIT
ELI-43655h	Lifescience Market	96 Tests	EUR 824

Mouse Pigq ELISA KIT
ELI-43656m	Lifescience Market	96 Tests	EUR 865

Human PIGQ shRNA Plasmid
20-abx956004	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PIGQ shRNA Plasmid
20-abx970628	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PIGQ Recombinant Protein (Human)
RP023476	ABM	100 ug	Ask for price

PIGQ Recombinant Protein (Mouse)
RP162071	ABM	100 ug	Ask for price

PIGQ Recombinant Protein (Rat)
RP220490	ABM	100 ug	Ask for price

Phosphatidylinositol N-Acetylglucosaminyltransferase Subunit Q (PIGQ) Antibody
20-abx217768	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Pigq ORF Vector (Rat) (pORF)
ORF073498	ABM	1.0 ug DNA	EUR 506

PIGQ ORF Vector (Human) (pORF)
ORF007826	ABM	1.0 ug DNA	EUR 95

Pigq ORF Vector (Mouse) (pORF)
ORF054025	ABM	1.0 ug DNA	EUR 506

Pigq sgRNA CRISPR Lentivector set (Mouse)
K4911601	ABM	3 x 1.0 ug	EUR 339

Pigq sgRNA CRISPR Lentivector set (Rat)
K7371601	ABM	3 x 1.0 ug	EUR 339

PIGQ sgRNA CRISPR Lentivector set (Human)
K1648101	ABM	3 x 1.0 ug	EUR 339

Pigq sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4911602	ABM	1.0 ug DNA	EUR 154

Pigq sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4911603	ABM	1.0 ug DNA	EUR 154

Pigq sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4911604	ABM	1.0 ug DNA	EUR 154

Pigq sgRNA CRISPR Lentivector (Rat) (Target 1)
K7371602	ABM	1.0 ug DNA	EUR 154

Pigq sgRNA CRISPR Lentivector (Rat) (Target 2)
K7371603	ABM	1.0 ug DNA	EUR 154

Pigq sgRNA CRISPR Lentivector (Rat) (Target 3)
K7371604	ABM	1.0 ug DNA	EUR 154

PIGQ sgRNA CRISPR Lentivector (Human) (Target 1)
K1648102	ABM	1.0 ug DNA	EUR 154

PIGQ sgRNA CRISPR Lentivector (Human) (Target 2)
K1648103	ABM	1.0 ug DNA	EUR 154

PIGQ sgRNA CRISPR Lentivector (Human) (Target 3)
K1648104	ABM	1.0 ug DNA	EUR 154

PIGQ Protein Vector (Rat) (pPB-C-His)
PV293990	ABM	500 ng	EUR 603

PIGQ Protein Vector (Rat) (pPB-N-His)
PV293991	ABM	500 ng	EUR 603

PIGQ Protein Vector (Rat) (pPM-C-HA)
PV293992	ABM	500 ng	EUR 603

PIGQ Protein Vector (Rat) (pPM-C-His)
PV293993	ABM	500 ng	EUR 603

PIGQ Protein Vector (Human) (pPB-C-His)
PV031301	ABM	500 ng	EUR 329

PIGQ Protein Vector (Human) (pPB-N-His)
PV031302	ABM	500 ng	EUR 329

PIGQ Protein Vector (Human) (pPM-C-HA)
PV031303	ABM	500 ng	EUR 329

PIGQ Protein Vector (Human) (pPM-C-His)
PV031304	ABM	500 ng	EUR 329

PIGQ Protein Vector (Mouse) (pPB-C-His)
PV216098	ABM	500 ng	EUR 603

PIGQ Protein Vector (Mouse) (pPB-N-His)
PV216099	ABM	500 ng	EUR 603

PIGQ Protein Vector (Mouse) (pPM-C-HA)
PV216100	ABM	500 ng	EUR 603

PIGQ Protein Vector (Mouse) (pPM-C-His)
PV216101	ABM	500 ng	EUR 603

Pigq 3'UTR Luciferase Stable Cell Line
TU116357	ABM	1.0 ml	Ask for price

Pigq 3'UTR GFP Stable Cell Line
TU166357	ABM	1.0 ml	Ask for price

Pigq 3'UTR Luciferase Stable Cell Line
TU216235	ABM	1.0 ml	Ask for price

Pigq 3'UTR GFP Stable Cell Line
TU266235	ABM	1.0 ml	Ask for price

PIGQ 3'UTR GFP Stable Cell Line
TU067941	ABM	1.0 ml	EUR 1394

PIGQ 3'UTR Luciferase Stable Cell Line
TU017941	ABM	1.0 ml	EUR 1394

PIGQ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV634447	ABM	1.0 ug DNA	EUR 682

PIGQ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV634451	ABM	1.0 ug DNA	EUR 682

PIGQ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV634452	ABM	1.0 ug DNA	EUR 682

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of NM23A of NME1 Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of ATM of ATM Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

PIGQ Rabbit Polyclonal Antibody