RGS17 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
RGS17 Polyclonal Antibody |
ABP60153-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of RGS17 from Human, Mouse. This RGS17 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150 |
RGS17 Polyclonal Antibody |
ABP60153-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150
- Applications tips:
|
Description: A polyclonal antibody for detection of RGS17 from Human, Mouse. This RGS17 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RGS17 protein at amino acid sequence of 70-150 |
RGS17 Polyclonal Antibody |
ES10147-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RGS17 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RGS17 Polyclonal Antibody |
ES10147-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RGS17 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RGS17 Rabbit pAb |
A15815-100ul |
Abclonal |
100 ul |
EUR 308 |
RGS17 Rabbit pAb |
A15815-200ul |
Abclonal |
200 ul |
EUR 459 |
RGS17 Rabbit pAb |
A15815-20ul |
Abclonal |
20 ul |
EUR 183 |
RGS17 Rabbit pAb |
A15815-50ul |
Abclonal |
50 ul |
EUR 223 |
RGS17 Polyclonal Conjugated Antibody |
C29434 |
SAB |
100ul |
EUR 397 |
RGS17 antibody |
22501-100ul |
SAB |
100ul |
EUR 390 |
RGS17 antibody |
70R-13010 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal RGS17 antibody |
RGS17 Antibody |
DF9844 |
Affbiotech |
200ul |
EUR 304 |
Description: RGS17 Antibody detects endogenous levels of total RGS17. |
RGS17 antibody |
70R-51373 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal RGS17 antibody |
Polyclonal RGS17 / RGSZ2 Antibody (C-Term) |
AMM07585G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RGS17 / RGSZ2 (C-Term). This antibody is tested and proven to work in the following applications: |
Polyclonal RGS17 Antibody - C-terminal region |
AMM07586G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RGS17 - C-terminal region. This antibody is tested and proven to work in the following applications: |
anti- RGS17 antibody |
FNab07268 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: regulator of G-protein signaling 17
- Uniprot ID: Q9UGC6
- Gene ID: 26575
- Research Area: Signal Transduction
|
Description: Antibody raised against RGS17 |
Anti-RGS17 antibody |
STJ191305 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RGS17 |
RGS17 siRNA |
20-abx931398 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RGS17 siRNA |
20-abx931399 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RGS17 |
YF-PA26007 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to RGS17 |
Human RGS17/RGSZ2 Antibody |
32841-05111 |
AssayPro |
150 ug |
EUR 261 |
RGS17 Blocking Peptide |
DF9844-BP |
Affbiotech |
1mg |
EUR 195 |
RGS17 Blocking Peptide |
20-abx064248 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RGS17 cloning plasmid |
CSB-CL019648HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 633
- Sequence: atgcgaaaaaggcagcagtcccaaaatgaaggaacacctgccgtgtctcaagctcctggaaaccagaggcccaacaacacctgttgcttttgttggtgctgttgttgcagctgctcctgcctcactgtgaggaatgaagaaagaggggaaaatgcgggaagacccacacacactac
- Show more
|
Description: A cloning plasmid for the RGS17 gene. |
Anti-RGS17 (2H4) |
YF-MA18126 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to RGS17 |
Human RGS17/RGSZ2 Antibody (Biotin Conjugate) |
32841-05121 |
AssayPro |
150 ug |
EUR 369 |
RGS17 protein (His tag) |
80R-1956 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Recombinant human RGS17 protein |
RGS17 Rabbit Polyclonal Antibody