RHOJ Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

RHOJ Polyclonal Antibody
ABP60170-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RHOJ protein at amino acid sequence of 30-110 Applications tips:
Description: A polyclonal antibody for detection of RHOJ from Human, Mouse. This RHOJ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOJ protein at amino acid sequence of 30-110

RHOJ Polyclonal Antibody
ES10175-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RHOJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHOJ Polyclonal Antibody
ES10175-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RHOJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RHOJ Antibody
1-CSB-PA872495LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RHOJ antibody
70R-4532	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal RHOJ antibody raised against the middle region of RHOJ

RHOJ Polyclonal Antibody, HRP Conjugated
A67495	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

RHOJ Polyclonal Antibody, FITC Conjugated
A67496	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

RHOJ Polyclonal Antibody, Biotin Conjugated
A67497	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Anti-RHOJ antibody
STJ191333	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RHOJ

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody
abx026427-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody
abx026427-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody
abx145094-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody
20-abx301688	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RHOJ siRNA
20-abx931482	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RHOJ siRNA
20-abx931483	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody (HRP)
20-abx311170	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody (FITC)
20-abx311171	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody (Biotin)
20-abx311172	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

RHOJ Antibody, HRP conjugated
1-CSB-PA872495LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RHOJ Antibody, FITC conjugated
1-CSB-PA872495LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RHOJ Antibody, Biotin conjugated
1-CSB-PA872495LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RHOJ Blocking Peptide
33R-4988	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHOJ antibody, catalog no. 70R-4532

RHOJ cloning plasmid
CSB-CL872495HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 645 Sequence: atgaactgcaaagagggaactgacagcagctgcggctgcaggggcaacgacgagaagaagatgttgaagtgtgtggtggtgggggacggtgccgtggggaaaacctgcctgctgatgagctacgccaacgacgccttcccagaggaatacgtgcccactgtgtttgaccactatgc Show more
Description: A cloning plasmid for the RHOJ gene.

Anti-RHOJ (1E4)
YF-MA11605	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RHOJ

Human Rho- related GTP- binding protein RhoJ, RHOJ ELISA KIT
ELI-30325h	Lifescience Market	96 Tests	EUR 824

Mouse Rho- related GTP- binding protein RhoJ, Rhoj ELISA KIT
ELI-30326m	Lifescience Market	96 Tests	EUR 865

Mouse RHOJ shRNA Plasmid
20-abx979044	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RHOJ shRNA Plasmid
20-abx961425	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RHOJ Recombinant Protein (Human)
RP026404	ABM	100 ug	Ask for price

RHOJ Recombinant Protein (Mouse)
RP168038	ABM	100 ug	Ask for price

RHOJ Recombinant Protein (Rat)
RP226055	ABM	100 ug	Ask for price

Monoclonal RHOJ Antibody (monoclonal) (M01), Clone: 1E5
AMM07610G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human RHOJ (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1E5. This antibody is applicable in WB and IF, E

Rhoj ORF Vector (Rat) (pORF)
ORF075353	ABM	1.0 ug DNA	EUR 506

RHOJ ORF Vector (Human) (pORF)
ORF008802	ABM	1.0 ug DNA	EUR 95

Rhoj ORF Vector (Mouse) (pORF)
ORF056014	ABM	1.0 ug DNA	EUR 506

Monoclonal TCL / RHOJ Antibody (clone 1D7), Clone: 1D7
AMM08134G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human TCL / RHOJ (clone 1D7). The antibodies are raised in Mouse and are from clone 1D7. This antibody is applicable in WB and IHC-P, IF

Rhoj sgRNA CRISPR Lentivector set (Rat)
K7150801	ABM	3 x 1.0 ug	EUR 339

RHOJ sgRNA CRISPR Lentivector set (Human)
K1821601	ABM	3 x 1.0 ug	EUR 339

Rhoj sgRNA CRISPR Lentivector set (Mouse)
K4094401	ABM	3 x 1.0 ug	EUR 339

Rhoj sgRNA CRISPR Lentivector (Rat) (Target 1)
K7150802	ABM	1.0 ug DNA	EUR 154

Rhoj sgRNA CRISPR Lentivector (Rat) (Target 2)
K7150803	ABM	1.0 ug DNA	EUR 154

Rhoj sgRNA CRISPR Lentivector (Rat) (Target 3)
K7150804	ABM	1.0 ug DNA	EUR 154

RHOJ sgRNA CRISPR Lentivector (Human) (Target 1)
K1821602	ABM	1.0 ug DNA	EUR 154

RHOJ sgRNA CRISPR Lentivector (Human) (Target 2)
K1821603	ABM	1.0 ug DNA	EUR 154

RHOJ sgRNA CRISPR Lentivector (Human) (Target 3)
K1821604	ABM	1.0 ug DNA	EUR 154

Rhoj sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4094402	ABM	1.0 ug DNA	EUR 154

Rhoj sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4094403	ABM	1.0 ug DNA	EUR 154

Rhoj sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4094404	ABM	1.0 ug DNA	EUR 154

RHOJ Protein Vector (Rat) (pPB-C-His)
PV301410	ABM	500 ng	EUR 603

RHOJ Protein Vector (Rat) (pPB-N-His)
PV301411	ABM	500 ng	EUR 603

RHOJ Protein Vector (Rat) (pPM-C-HA)
PV301412	ABM	500 ng	EUR 603

RHOJ Protein Vector (Rat) (pPM-C-His)
PV301413	ABM	500 ng	EUR 603

RHOJ Protein Vector (Human) (pPB-C-His)
PV035205	ABM	500 ng	EUR 329

RHOJ Protein Vector (Human) (pPB-N-His)
PV035206	ABM	500 ng	EUR 329

RHOJ Protein Vector (Human) (pPM-C-HA)
PV035207	ABM	500 ng	EUR 329

RHOJ Protein Vector (Human) (pPM-C-His)
PV035208	ABM	500 ng	EUR 329

RHOJ Protein Vector (Mouse) (pPB-C-His)
PV224054	ABM	500 ng	EUR 603

RHOJ Protein Vector (Mouse) (pPB-N-His)
PV224055	ABM	500 ng	EUR 603

RHOJ Protein Vector (Mouse) (pPM-C-HA)
PV224056	ABM	500 ng	EUR 603

RHOJ Protein Vector (Mouse) (pPM-C-His)
PV224057	ABM	500 ng	EUR 603

Rhoj 3'UTR Luciferase Stable Cell Line
TU117837	ABM	1.0 ml	Ask for price

RHOJ Rabbit Polyclonal Antibody