RHOJ Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
RHOJ Polyclonal Antibody |
ABP60170-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RHOJ protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of RHOJ from Human, Mouse. This RHOJ antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHOJ protein at amino acid sequence of 30-110 |
RHOJ Polyclonal Antibody |
ES10175-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RHOJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RHOJ Polyclonal Antibody |
ES10175-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RHOJ from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RHOJ Antibody |
1-CSB-PA872495LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
RHOJ antibody |
70R-4532 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal RHOJ antibody raised against the middle region of RHOJ |
RHOJ Polyclonal Antibody, HRP Conjugated |
A67495 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
RHOJ Polyclonal Antibody, FITC Conjugated |
A67496 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
RHOJ Polyclonal Antibody, Biotin Conjugated |
A67497 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Anti-RHOJ antibody |
STJ191333 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RHOJ |
Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody |
abx026427-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody |
abx026427-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody |
abx145094-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody |
20-abx301688 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RHOJ siRNA |
20-abx931482 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RHOJ siRNA |
20-abx931483 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody (HRP) |
20-abx311170 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody (FITC) |
20-abx311171 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoJ (RHOJ) Antibody (Biotin) |
20-abx311172 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
RHOJ Antibody, HRP conjugated |
1-CSB-PA872495LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RHOJ Antibody, FITC conjugated |
1-CSB-PA872495LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RHOJ Antibody, Biotin conjugated |
1-CSB-PA872495LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RHOJ. Recognizes RHOJ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
RHOJ Blocking Peptide |
33R-4988 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RHOJ antibody, catalog no. 70R-4532 |
RHOJ cloning plasmid |
CSB-CL872495HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 645
- Sequence: atgaactgcaaagagggaactgacagcagctgcggctgcaggggcaacgacgagaagaagatgttgaagtgtgtggtggtgggggacggtgccgtggggaaaacctgcctgctgatgagctacgccaacgacgccttcccagaggaatacgtgcccactgtgtttgaccactatgc
- Show more
|
Description: A cloning plasmid for the RHOJ gene. |
Anti-RHOJ (1E4) |
YF-MA11605 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RHOJ |
Human Rho- related GTP- binding protein RhoJ, RHOJ ELISA KIT |
ELI-30325h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Rho- related GTP- binding protein RhoJ, Rhoj ELISA KIT |
ELI-30326m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse RHOJ shRNA Plasmid |
20-abx979044 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RHOJ shRNA Plasmid |
20-abx961425 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RHOJ Recombinant Protein (Human) |
RP026404 |
ABM |
100 ug |
Ask for price |
RHOJ Recombinant Protein (Mouse) |
RP168038 |
ABM |
100 ug |
Ask for price |
RHOJ Recombinant Protein (Rat) |
RP226055 |
ABM |
100 ug |
Ask for price |
Monoclonal RHOJ Antibody (monoclonal) (M01), Clone: 1E5 |
AMM07610G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human RHOJ (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1E5. This antibody is applicable in WB and IF, E |
Rhoj ORF Vector (Rat) (pORF) |
ORF075353 |
ABM |
1.0 ug DNA |
EUR 506 |
RHOJ ORF Vector (Human) (pORF) |
ORF008802 |
ABM |
1.0 ug DNA |
EUR 95 |
Rhoj ORF Vector (Mouse) (pORF) |
ORF056014 |
ABM |
1.0 ug DNA |
EUR 506 |
Monoclonal TCL / RHOJ Antibody (clone 1D7), Clone: 1D7 |
AMM08134G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human TCL / RHOJ (clone 1D7). The antibodies are raised in Mouse and are from clone 1D7. This antibody is applicable in WB and IHC-P, IF |
Rhoj sgRNA CRISPR Lentivector set (Rat) |
K7150801 |
ABM |
3 x 1.0 ug |
EUR 339 |
RHOJ sgRNA CRISPR Lentivector set (Human) |
K1821601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rhoj sgRNA CRISPR Lentivector set (Mouse) |
K4094401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rhoj sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7150802 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhoj sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7150803 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhoj sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7150804 |
ABM |
1.0 ug DNA |
EUR 154 |
RHOJ sgRNA CRISPR Lentivector (Human) (Target 1) |
K1821602 |
ABM |
1.0 ug DNA |
EUR 154 |
RHOJ sgRNA CRISPR Lentivector (Human) (Target 2) |
K1821603 |
ABM |
1.0 ug DNA |
EUR 154 |
RHOJ sgRNA CRISPR Lentivector (Human) (Target 3) |
K1821604 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhoj sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4094402 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhoj sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4094403 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhoj sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4094404 |
ABM |
1.0 ug DNA |
EUR 154 |
RHOJ Protein Vector (Rat) (pPB-C-His) |
PV301410 |
ABM |
500 ng |
EUR 603 |
RHOJ Protein Vector (Rat) (pPB-N-His) |
PV301411 |
ABM |
500 ng |
EUR 603 |
RHOJ Protein Vector (Rat) (pPM-C-HA) |
PV301412 |
ABM |
500 ng |
EUR 603 |
RHOJ Protein Vector (Rat) (pPM-C-His) |
PV301413 |
ABM |
500 ng |
EUR 603 |
RHOJ Protein Vector (Human) (pPB-C-His) |
PV035205 |
ABM |
500 ng |
EUR 329 |
RHOJ Protein Vector (Human) (pPB-N-His) |
PV035206 |
ABM |
500 ng |
EUR 329 |
RHOJ Protein Vector (Human) (pPM-C-HA) |
PV035207 |
ABM |
500 ng |
EUR 329 |
RHOJ Protein Vector (Human) (pPM-C-His) |
PV035208 |
ABM |
500 ng |
EUR 329 |
RHOJ Protein Vector (Mouse) (pPB-C-His) |
PV224054 |
ABM |
500 ng |
EUR 603 |
RHOJ Protein Vector (Mouse) (pPB-N-His) |
PV224055 |
ABM |
500 ng |
EUR 603 |
RHOJ Protein Vector (Mouse) (pPM-C-HA) |
PV224056 |
ABM |
500 ng |
EUR 603 |
RHOJ Protein Vector (Mouse) (pPM-C-His) |
PV224057 |
ABM |
500 ng |
EUR 603 |
Rhoj 3'UTR Luciferase Stable Cell Line |
TU117837 |
ABM |
1.0 ml |
Ask for price |
RHOJ Rabbit Polyclonal Antibody