RHPN2 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
RHPN2 Polyclonal Antibody |
ABP60172-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RHPN2 protein at amino acid sequence of 110-190
- Applications tips:
|
Description: A polyclonal antibody for detection of RHPN2 from Human, Mouse. This RHPN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHPN2 protein at amino acid sequence of 110-190 |
RHPN2 Polyclonal Antibody |
ABP60172-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RHPN2 protein at amino acid sequence of 110-190
- Applications tips:
|
Description: A polyclonal antibody for detection of RHPN2 from Human, Mouse. This RHPN2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RHPN2 protein at amino acid sequence of 110-190 |
anti- RHPN2 antibody |
FNab07290 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: rhophilin, Rho GTPase binding protein 2
- Uniprot ID: Q8IUC4
- Gene ID: 85415
- Research Area: Signal Transduction
|
Description: Antibody raised against RHPN2 |
Anti-RHPN2 antibody |
STJ191329 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RHPN2 |
RHPN2 siRNA |
20-abx931502 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RHPN2 siRNA |
20-abx931503 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RHPN2 |
YF-PA27648 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to RHPN2 |
RHPN2 cloning plasmid |
CSB-CL815544HU-10ug |
Cusabio |
10ug |
EUR 686 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2061
- Sequence: atgaccgacgcgctgttgcccgcggccccccagccgctggagaagaagaacgacggctactttcggaagggctgtaatccccttgcacaaaccggccggagtaaattgcagaatcaaagagctgctttgaatcagcagatcctgaaagccgtgcggatgaggaccggagcggaaa
- Show more
|
Description: A cloning plasmid for the RHPN2 gene. |
Mouse RHPN2 shRNA Plasmid |
20-abx974234 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RHPN2 shRNA Plasmid |
20-abx963802 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RHPN2 Recombinant Protein (Human) |
RP026419 |
ABM |
100 ug |
Ask for price |
RHPN2 Recombinant Protein (Rat) |
RP226100 |
ABM |
100 ug |
Ask for price |
RHPN2 Recombinant Protein (Mouse) |
RP168161 |
ABM |
100 ug |
Ask for price |
RHPN2 ORF Vector (Human) (pORF) |
ORF008807 |
ABM |
1.0 ug DNA |
EUR 95 |
Rhpn2 ORF Vector (Mouse) (pORF) |
ORF056055 |
ABM |
1.0 ug DNA |
EUR 506 |
Rhpn2 ORF Vector (Rat) (pORF) |
ORF075368 |
ABM |
1.0 ug DNA |
EUR 506 |
Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody |
abx145071-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody |
abx030913-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody |
abx030913-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Rhophilin Rho GTPase Binding Protein 2 (RHPN2) Antibody |
abx237290-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Human Rhophilin 2 (RHPN2)ELISA Kit |
201-12-2513 |
SunredBio |
96 tests |
EUR 440 |
- This Rhophilin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
RHPN2 sgRNA CRISPR Lentivector set (Human) |
K1822701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rhpn2 sgRNA CRISPR Lentivector set (Rat) |
K6103001 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rhpn2 sgRNA CRISPR Lentivector set (Mouse) |
K4853001 |
ABM |
3 x 1.0 ug |
EUR 339 |
RHPN2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1822702 |
ABM |
1.0 ug DNA |
EUR 154 |
RHPN2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1822703 |
ABM |
1.0 ug DNA |
EUR 154 |
RHPN2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1822704 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhpn2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6103002 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhpn2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6103003 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhpn2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6103004 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhpn2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4853002 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhpn2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4853003 |
ABM |
1.0 ug DNA |
EUR 154 |
Rhpn2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4853004 |
ABM |
1.0 ug DNA |
EUR 154 |
RHPN2 Protein Vector (Human) (pPB-C-His) |
PV035225 |
ABM |
500 ng |
EUR 329 |
RHPN2 Protein Vector (Human) (pPB-N-His) |
PV035226 |
ABM |
500 ng |
EUR 329 |
RHPN2 Protein Vector (Human) (pPM-C-HA) |
PV035227 |
ABM |
500 ng |
EUR 329 |
RHPN2 Protein Vector (Human) (pPM-C-His) |
PV035228 |
ABM |
500 ng |
EUR 329 |
RHPN2 Protein Vector (Rat) (pPB-C-His) |
PV301470 |
ABM |
500 ng |
EUR 1166 |
RHPN2 Protein Vector (Rat) (pPB-N-His) |
PV301471 |
ABM |
500 ng |
EUR 1166 |
RHPN2 Protein Vector (Rat) (pPM-C-HA) |
PV301472 |
ABM |
500 ng |
EUR 1166 |
RHPN2 Protein Vector (Rat) (pPM-C-His) |
PV301473 |
ABM |
500 ng |
EUR 1166 |
RHPN2 Protein Vector (Mouse) (pPB-C-His) |
PV224218 |
ABM |
500 ng |
EUR 1065 |
RHPN2 Protein Vector (Mouse) (pPB-N-His) |
PV224219 |
ABM |
500 ng |
EUR 1065 |
RHPN2 Protein Vector (Mouse) (pPM-C-HA) |
PV224220 |
ABM |
500 ng |
EUR 1065 |
RHPN2 Protein Vector (Mouse) (pPM-C-His) |
PV224221 |
ABM |
500 ng |
EUR 1065 |
Rhpn2 3'UTR GFP Stable Cell Line |
TU167875 |
ABM |
1.0 ml |
Ask for price |
RHPN2 3'UTR Luciferase Stable Cell Line |
TU019903 |
ABM |
1.0 ml |
EUR 1394 |
Rhpn2 3'UTR Luciferase Stable Cell Line |
TU117875 |
ABM |
1.0 ml |
Ask for price |
RHPN2 3'UTR GFP Stable Cell Line |
TU069903 |
ABM |
1.0 ml |
EUR 1394 |
Rhpn2 3'UTR Luciferase Stable Cell Line |
TU219428 |
ABM |
1.0 ml |
Ask for price |
RHPN2 Rabbit Polyclonal Antibody