RND1 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
RND1 Polyclonal Antibody |
ABP60217-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RND1 protein at amino acid sequence of 140-220
- Applications tips:
|
Description: A polyclonal antibody for detection of RND1 from Human, Mouse. This RND1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RND1 protein at amino acid sequence of 140-220 |
RND1 Polyclonal Antibody |
ES10172-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RND1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RND1 Polyclonal Antibody |
ES10172-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RND1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RND1 Rabbit pAb |
A13705-100ul |
Abclonal |
100 ul |
EUR 308 |
RND1 Rabbit pAb |
A13705-200ul |
Abclonal |
200 ul |
EUR 459 |
RND1 Rabbit pAb |
A13705-20ul |
Abclonal |
20 ul |
EUR 183 |
RND1 Rabbit pAb |
A13705-50ul |
Abclonal |
50 ul |
EUR 223 |
RND1 Polyclonal Conjugated Antibody |
C28315 |
SAB |
100ul |
EUR 397 |
RND1 Antibody |
1-CSB-PA835694LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
Polyclonal RND1 antibody - C-terminal region |
AMM07634G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RND1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Anti-RND1 Antibody |
A06347 |
BosterBio |
100ug/vial |
EUR 294 |
Human RND1 Antibody |
33296-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-RND1 antibody |
STJ115660 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that belongs to the Rho GTPase family. Members of this family regulate the organization of the actin cytoskeleton in response to extracellular growth factors. A similar protein in rat interacts with a microtubule regulator to control axon extension. |
Anti-RND1 antibody |
STJ191330 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RND1 |
RND1 siRNA |
20-abx931647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RND1 siRNA |
20-abx931648 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RND1 |
YF-PA18451 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to RND1 |
anti-RND1 |
YF-PA26055 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to RND1 |
RND1 Antibody, HRP conjugated |
1-CSB-PA835694LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RND1 Antibody, FITC conjugated |
1-CSB-PA835694LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RND1 Antibody, Biotin conjugated |
1-CSB-PA835694LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND1. Recognizes RND1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human) |
4-PAB788Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RND1 (Met1~Cys229)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1) |
RND1 cloning plasmid |
CSB-CL835694HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 699
- Sequence: atgaaggagagacgggccccccagccagtcgtggccagatgtaagctcgttctggtcggggacgtgcagtgtgggaagaccgcgatgttgcaagtgttagcgaaggattgctatccagagacctatgtgcccaccgtgttcgaaaattacacagcctgtttggagacagaggaaca
- Show more
|
Description: A cloning plasmid for the RND1 gene. |
Human RND1 Antibody (Biotin Conjugate) |
33296-05121 |
AssayPro |
150 ug |
EUR 369 |
Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), APC |
4-PAB788Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RND1 (Met1~Cys229)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with APC. |
Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), Biotinylated |
4-PAB788Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RND1 (Met1~Cys229)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with Biotin. |
Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), Cy3 |
4-PAB788Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RND1 (Met1~Cys229)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with Cy3. |
Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), FITC |
4-PAB788Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RND1 (Met1~Cys229)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with FITC. |
Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), HRP |
4-PAB788Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RND1 (Met1~Cys229)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with HRP. |
Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), PE |
4-PAB788Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RND1 (Met1~Cys229)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with PE. |
Rabbit Rho Family GTPase 1 (RND1) ELISA Kit |
abx362433-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
RND1 protein (His tag) |
80R-1902 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant RND1 protein |
Human RND1 shRNA Plasmid |
20-abx959056 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RND1 shRNA Plasmid |
20-abx981301 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RND1 Recombinant Protein (Human) |
RP026542 |
ABM |
100 ug |
Ask for price |
RND1 Recombinant Protein (Mouse) |
RP168404 |
ABM |
100 ug |
Ask for price |
RND1 Recombinant Protein (Rat) |
RP226265 |
ABM |
100 ug |
Ask for price |
Human RND1 AssayLite Antibody (FITC Conjugate) |
33296-05141 |
AssayPro |
150 ug |
EUR 428 |
Human RND1 AssayLite Antibody (RPE Conjugate) |
33296-05151 |
AssayPro |
150 ug |
EUR 428 |
Human RND1 AssayLite Antibody (APC Conjugate) |
33296-05161 |
AssayPro |
150 ug |
EUR 428 |
Human RND1 AssayLite Antibody (PerCP Conjugate) |
33296-05171 |
AssayPro |
150 ug |
EUR 471 |
Rho Family GTPase 1 (RND1) Antibody |
20-abx130669 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rho Family GTPase 1 (RND1) Antibody |
abx145149-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Rho Family GTPase 1 (RND1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB788Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: RND1 (Met1~Cys229)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Rho Family GTPase 1 (RND1). This antibody is labeled with APC-Cy7. |
Rnd1 ORF Vector (Rat) (pORF) |
ORF075423 |
ABM |
1.0 ug DNA |
EUR 506 |
RND1 ORF Vector (Human) (pORF) |
ORF008848 |
ABM |
1.0 ug DNA |
EUR 95 |
Rnd1 ORF Vector (Mouse) (pORF) |
ORF056136 |
ABM |
1.0 ug DNA |
EUR 506 |
Rnd1 sgRNA CRISPR Lentivector set (Rat) |
K7333401 |
ABM |
3 x 1.0 ug |
EUR 339 |
RND1 sgRNA CRISPR Lentivector set (Human) |
K1833501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Rnd1 sgRNA CRISPR Lentivector set (Mouse) |
K3616701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Recombinant Rho Family GTPase 1 (RND1) |
4-RPB788Hu01 |
Cloud-Clone |
-
EUR 377.76
-
EUR 204.00
-
EUR 1141.60
-
EUR 447.20
-
EUR 794.40
-
EUR 316.00
-
EUR 2704.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q92730
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.4kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Rho Family GTPase 1 expressed in: E.coli |
Human Rho Family GTPase 1 (RND1) Protein |
20-abx168764 |
Abbexa |
-
EUR 537.00
-
EUR 244.00
-
EUR 1553.00
-
EUR 634.00
-
EUR 398.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Rnd1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7333402 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7333403 |
ABM |
1.0 ug DNA |
EUR 154 |
Rnd1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7333404 |
ABM |
1.0 ug DNA |
EUR 154 |
RND1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1833502 |
ABM |
1.0 ug DNA |
EUR 154 |
RND1 Rabbit Polyclonal Antibody