RND3 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
RND3 Polyclonal Antibody |
ABP60219-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230
- Applications tips:
|
Description: A polyclonal antibody for detection of RND3 from Human, Mouse, Rat. This RND3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230 |
RND3 Polyclonal Antibody |
ABP60219-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230
- Applications tips:
|
Description: A polyclonal antibody for detection of RND3 from Human, Mouse, Rat. This RND3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230 |
RND3 Polyclonal Antibody |
ES10173-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against RND3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RND3 Polyclonal Antibody |
ES10173-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against RND3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
RND3 Rabbit pAb |
A11637-100ul |
Abclonal |
100 ul |
EUR 308 |
RND3 Rabbit pAb |
A11637-200ul |
Abclonal |
200 ul |
EUR 459 |
RND3 Rabbit pAb |
A11637-20ul |
Abclonal |
20 ul |
EUR 183 |
RND3 Rabbit pAb |
A11637-50ul |
Abclonal |
50 ul |
EUR 223 |
RND3 Rabbit pAb |
A17402-100ul |
Abclonal |
100 ul |
EUR 308 |
RND3 Rabbit pAb |
A17402-200ul |
Abclonal |
200 ul |
Ask for price |
RND3 Rabbit pAb |
A17402-20ul |
Abclonal |
20 ul |
Ask for price |
RND3 Rabbit pAb |
A17402-50ul |
Abclonal |
50 ul |
Ask for price |
RND3 antibody |
70R-19917 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal RND3 antibody |
RND3 Antibody |
48418-100ul |
SAB |
100ul |
EUR 333 |
RND3 Antibody |
48418-50ul |
SAB |
50ul |
EUR 239 |
RND3 Antibody |
DF12311 |
Affbiotech |
200ul |
EUR 304 |
Description: RND3 antibody detects endogenous levels of RND3. |
RND3 Antibody |
1-CSB-PA019813GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
RND3 Antibody |
1-CSB-PA019813LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Human RND3 Antibody |
33068-05111 |
AssayPro |
150 ug |
EUR 261 |
RND3 Conjugated Antibody |
C48418 |
SAB |
100ul |
EUR 397 |
anti- RND3 antibody |
FNab07333 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: Rho family GTPase 3
- Uniprot ID: P61587
- Gene ID: 390
- Research Area: Signal Transduction
|
Description: Antibody raised against RND3 |
anti- RND3 antibody |
FNab07334 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- Immunogen: Rho family GTPase 3
- Uniprot ID: P61587
- Gene ID: 390
- Research Area: Signal Transduction
|
Description: Antibody raised against RND3 |
Anti-RND3 antibody |
STJ113242 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified. |
Anti-RND3 antibody |
STJ119524 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified. |
Anti-RND3 antibody |
STJ191331 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to RND3 |
RND3 siRNA |
20-abx904598 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RND3 siRNA |
20-abx931651 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RND3 siRNA |
20-abx931652 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-RND3 |
YF-PA10316 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to RND3 |
anti-RND3 |
YF-PA10317 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to RND3 |
RND3 Antibody, HRP conjugated |
1-CSB-PA019813LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
RND3 Antibody, FITC conjugated |
1-CSB-PA019813LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
RND3 Antibody, Biotin conjugated |
1-CSB-PA019813LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
RND3 Blocking Peptide |
DF12311-BP |
Affbiotech |
1mg |
EUR 195 |
RND3 cloning plasmid |
CSB-CL019813HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 735
- Sequence: atgaaggagagaagagccagccagaaattatccagcaaatctatcatggatcctaatcagaacgtgaaatgcaagatagttgtggtgggagacagtcagtgtggaaaaactgcgctgctccatgtcttcgccaaggactgcttccccgagaattacgttcctacagtgtttgagaa
- Show more
|
Description: A cloning plasmid for the RND3 gene. |
Anti-RND3 (1D2) |
YF-MA10058 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to RND3 |
Human RND3 Antibody (Biotin Conjugate) |
33068-05121 |
AssayPro |
150 ug |
EUR 369 |
Monoclonal RND3 Antibody, Clone: 5C7E8 |
AMM03058G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human RND3. The antibodies are raised in Mouse and are from clone 5C7E8. This antibody is applicable in WB and IHC, FC, ICC, E |
Monoclonal RND3 Antibody, Clone: 5C7B6 |
AMM03059G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human RND3. The antibodies are raised in Mouse and are from clone 5C7B6. This antibody is applicable in WB and IHC, FC, ICC, E |
RND3 protein (His tag) |
80R-1413 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human RND3 protein |
Rat RND3 shRNA Plasmid |
20-abx988763 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse RND3 shRNA Plasmid |
20-abx978141 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human RND3 shRNA Plasmid |
20-abx950279 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
RND3 Recombinant Protein (Human) |
RP026548 |
ABM |
100 ug |
Ask for price |
RND3 Recombinant Protein (Mouse) |
RP168410 |
ABM |
100 ug |
Ask for price |
RND3 Recombinant Protein (Rat) |
RP226271 |
ABM |
100 ug |
Ask for price |
Human RND3 AssayLite Antibody (FITC Conjugate) |
33068-05141 |
AssayPro |
150 ug |
EUR 428 |
Human RND3 AssayLite Antibody (RPE Conjugate) |
33068-05151 |
AssayPro |
150 ug |
EUR 428 |
Human RND3 AssayLite Antibody (APC Conjugate) |
33068-05161 |
AssayPro |
150 ug |
EUR 428 |
Human RND3 AssayLite Antibody (PerCP Conjugate) |
33068-05171 |
AssayPro |
150 ug |
EUR 471 |
Rho Family Gtpase 3 (RND3) Antibody |
20-abx115177 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Rnd3 ORF Vector (Rat) (pORF) |
ORF075425 |
ABM |
1.0 ug DNA |
EUR 506 |
RND3 ORF Vector (Human) (pORF) |
ORF008850 |
ABM |
1.0 ug DNA |
EUR 95 |
Rnd3 ORF Vector (Mouse) (pORF) |
ORF056138 |
ABM |
1.0 ug DNA |
EUR 506 |
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody |
abx016165-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
Rho-Related GTP-Binding Protein RhoE (RND3) Antibody |
abx224184-100ug |
Abbexa |
100 ug |
EUR 411 |
- Shipped within 5-10 working days.
|
RND3 Rabbit Polyclonal Antibody