RND3 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

RND3 Polyclonal Antibody
ABP60219-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230 Applications tips:
Description: A polyclonal antibody for detection of RND3 from Human, Mouse, Rat. This RND3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230

RND3 Polyclonal Antibody
ABP60219-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230 Applications tips:
Description: A polyclonal antibody for detection of RND3 from Human, Mouse, Rat. This RND3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RND3 protein at amino acid sequence of 150-230

RND3 Polyclonal Antibody
ES10173-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against RND3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RND3 Polyclonal Antibody
ES10173-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against RND3 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RND3 Rabbit pAb
A11637-100ul	Abclonal	100 ul	EUR 308

RND3 Rabbit pAb
A11637-200ul	Abclonal	200 ul	EUR 459

RND3 Rabbit pAb
A11637-20ul	Abclonal	20 ul	EUR 183

RND3 Rabbit pAb
A11637-50ul	Abclonal	50 ul	EUR 223

RND3 Rabbit pAb
A17402-100ul	Abclonal	100 ul	EUR 308

RND3 Rabbit pAb
A17402-200ul	Abclonal	200 ul	Ask for price

RND3 Rabbit pAb
A17402-20ul	Abclonal	20 ul	Ask for price

RND3 Rabbit pAb
A17402-50ul	Abclonal	50 ul	Ask for price

RND3 antibody
70R-19917	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal RND3 antibody

RND3 Antibody
48418-100ul	SAB	100ul	EUR 333

RND3 Antibody
48418-50ul	SAB	50ul	EUR 239

RND3 Antibody
DF12311	Affbiotech	200ul	EUR 304
Description: RND3 antibody detects endogenous levels of RND3.

RND3 Antibody
1-CSB-PA019813GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RND3 Antibody
1-CSB-PA019813LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Rnd3/ Rat Rnd3 ELISA Kit
ELI-14681r	Lifescience Market	96 Tests	EUR 886

Human RND3 Antibody
33068-05111	AssayPro	150 ug	EUR 261

RND3 Conjugated Antibody
C48418	SAB	100ul	EUR 397

anti- RND3 antibody
FNab07333	FN Test	100µg	EUR 548.75
Immunogen: Rho family GTPase 3 Uniprot ID: P61587 Gene ID: 390 Research Area: Signal Transduction
Description: Antibody raised against RND3

anti- RND3 antibody
FNab07334	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 Immunogen: Rho family GTPase 3 Uniprot ID: P61587 Gene ID: 390 Research Area: Signal Transduction
Description: Antibody raised against RND3

Anti-RND3 antibody
PAab07333	Lifescience Market	100 ug	EUR 386

Anti-RND3 antibody
STJ113242	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-RND3 antibody
STJ119524	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-RND3 antibody
STJ191331	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RND3

RND3 siRNA
20-abx904598	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RND3 siRNA
20-abx931651	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RND3 siRNA
20-abx931652	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-RND3
YF-PA10316	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to RND3

anti-RND3
YF-PA10317	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RND3

RND3 Antibody, HRP conjugated
1-CSB-PA019813LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RND3 Antibody, FITC conjugated
1-CSB-PA019813LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RND3 Antibody, Biotin conjugated
1-CSB-PA019813LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RND3. Recognizes RND3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RND3 Blocking Peptide
DF12311-BP	Affbiotech	1mg	EUR 195

RND3 cloning plasmid
CSB-CL019813HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 735 Sequence: atgaaggagagaagagccagccagaaattatccagcaaatctatcatggatcctaatcagaacgtgaaatgcaagatagttgtggtgggagacagtcagtgtggaaaaactgcgctgctccatgtcttcgccaaggactgcttccccgagaattacgttcctacagtgtttgagaa Show more
Description: A cloning plasmid for the RND3 gene.

Anti-RND3 (1D2)
YF-MA10058	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to RND3

Human RND3 Antibody (Biotin Conjugate)
33068-05121	AssayPro	150 ug	EUR 369

Monoclonal RND3 Antibody, Clone: 5C7E8
AMM03058G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human RND3. The antibodies are raised in Mouse and are from clone 5C7E8. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal RND3 Antibody, Clone: 5C7B6
AMM03059G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human RND3. The antibodies are raised in Mouse and are from clone 5C7B6. This antibody is applicable in WB and IHC, FC, ICC, E

RND3 protein (His tag)
80R-1413	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human RND3 protein

RND3 ELISA KIT|Human
EF002501	Lifescience Market	96 Tests	EUR 689

Rat RND3 shRNA Plasmid
20-abx988763	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RND3 shRNA Plasmid
20-abx978141	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RND3 shRNA Plasmid
20-abx950279	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RND3 Recombinant Protein (Human)
RP026548	ABM	100 ug	Ask for price

RND3 Recombinant Protein (Mouse)
RP168410	ABM	100 ug	Ask for price

RND3 Recombinant Protein (Rat)
RP226271	ABM	100 ug	Ask for price

Human RND3 AssayLite Antibody (FITC Conjugate)
33068-05141	AssayPro	150 ug	EUR 428

Human RND3 AssayLite Antibody (RPE Conjugate)
33068-05151	AssayPro	150 ug	EUR 428

Human RND3 AssayLite Antibody (APC Conjugate)
33068-05161	AssayPro	150 ug	EUR 428

Human RND3 AssayLite Antibody (PerCP Conjugate)
33068-05171	AssayPro	150 ug	EUR 471

Rho Family Gtpase 3 (RND3) Antibody
20-abx115177	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Rnd3 ORF Vector (Rat) (pORF)
ORF075425	ABM	1.0 ug DNA	EUR 506

RND3 ORF Vector (Human) (pORF)
ORF008850	ABM	1.0 ug DNA	EUR 95

Rnd3 ORF Vector (Mouse) (pORF)
ORF056138	ABM	1.0 ug DNA	EUR 506

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody
abx016165-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Rho-Related GTP-Binding Protein RhoE (RND3) Antibody
abx224184-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

RND3 Rabbit Polyclonal Antibody