ROBO1 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

ROBO1 Polyclonal Antibody
ABP60226-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ROBO1 protein at amino acid sequence of 730-810 Applications tips:
Description: A polyclonal antibody for detection of ROBO1 from Human, Mouse, Rat. This ROBO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ROBO1 protein at amino acid sequence of 730-810

ROBO1 Polyclonal Antibody
ABP60226-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ROBO1 protein at amino acid sequence of 730-810 Applications tips:
Description: A polyclonal antibody for detection of ROBO1 from Human, Mouse, Rat. This ROBO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ROBO1 protein at amino acid sequence of 730-810

ROBO1 Rabbit pAb
A15313-100ul	Abclonal	100 ul	EUR 308

ROBO1 Rabbit pAb
A15313-200ul	Abclonal	200 ul	EUR 459

ROBO1 Rabbit pAb
A15313-20ul	Abclonal	20 ul	EUR 183

ROBO1 Rabbit pAb
A15313-50ul	Abclonal	50 ul	EUR 223

ROBO1 Rabbit pAb
A19506-100ul	Abclonal	100 ul	Ask for price

ROBO1 Rabbit pAb
A19506-200ul	Abclonal	200 ul	Ask for price

ROBO1 Rabbit pAb
A19506-20ul	Abclonal	20 ul	Ask for price

ROBO1 Rabbit pAb
A19506-50ul	Abclonal	50 ul	EUR 308

ROBO1 Rabbit pAb
A9412-100ul	Abclonal	100 ul	EUR 308

ROBO1 Rabbit pAb
A9412-200ul	Abclonal	200 ul	EUR 459

ROBO1 Rabbit pAb
A9412-20ul	Abclonal	20 ul	EUR 183

ROBO1 Rabbit pAb
A9412-50ul	Abclonal	50 ul	Ask for price

Polyclonal ROBO1 Antibody (Internal)
APG01042G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ROBO1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal ROBO1 Antibody (Internal)
APG01234G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ROBO1 (Internal). This antibody is tested and proven to work in the following applications:

ROBO1 Antibody
ABD9877	Lifescience Market	100 ug	EUR 438

ROBO1 antibody
70R-21676	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ROBO1 antibody

ROBO1 Antibody
46218-100ul	SAB	100ul	EUR 252

ROBO1 Antibody
46218-50ul	SAB	50ul	EUR 187

ROBO1 Antibody
DF9877	Affbiotech	200ul	EUR 304
Description: ROBO1 Antibody detects endogenous levels of total ROBO1.

ROBO1 Antibody
1-CSB-PA896760LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

ROBO1 Antibody
1-CSB-PA020054GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Polyclonal ROBO1 Antibody (aa1632-1644)
APR02181G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ROBO1 (aa1632-1644). This antibody is tested and proven to work in the following applications:

ROBO1
GT15144	Neuromics	100 ug	EUR 526

ROBO1 Conjugated Antibody
C46218	SAB	100ul	EUR 397

ROBO1-Specific Antibody
abx237372-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Anti-ROBO1 Antibody
A01530-2	BosterBio	100ug/vial	EUR 294

Anti-ROBO1 antibody
STJ11100699	St John's Laboratory	50 µl	EUR 287
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ROBO1 antibody
STJ111690	St John's Laboratory	100 µl	EUR 277
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ROBO1 antibody
STJ117508	St John's Laboratory	100 µl	EUR 277
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-ROBO1 antibody
STJ191349	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ROBO1

Polyclonal Goat Anti-ROBO1 / DUTT1 (Internal) Antibody
APG00285G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ROBO1 / DUTT1 (Internal) . This antibody is tested and proven to work in the following applications:

ROBO1 siRNA
20-abx904630	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ROBO1 siRNA
20-abx931831	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ROBO1 siRNA
20-abx931832	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-Robo1
YF-PA24590	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Robo1

anti- ROBO1-Specific antibody
FNab07372	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 Immunogen: roundabout, axon guidance receptor, homolog 1(Drosophila) Uniprot ID: Q9Y6N7 Research Area: Neuroscience, Immunology, Cardiovascular, Developmental biology
Description: Antibody raised against ROBO1-Specific

Anti-ROBO1/DUTT1 Antibody
A01530	BosterBio	100ug/200ul	EUR 397
Description: Goat Polyclonal ROBO1/DUTT1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

ROBO1 Antibody, HRP conjugated
1-CSB-PA896760LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ROBO1 Antibody, FITC conjugated
1-CSB-PA896760LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ROBO1 Antibody, Biotin conjugated
1-CSB-PA896760LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-ROBO1-Specific antibody
PAab07372	Lifescience Market	100 ug	EUR 386

ROBO1 Blocking Peptide
20-abx161212	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

ROBO1 Blocking Peptide
DF9877-BP	Affbiotech	1mg	EUR 195

ROBO1 cloning plasmid
CSB-CL896760HU-10ug	Cusabio	10ug	EUR 1876
Formulation: 10 μg plasmid + 200μl Glycerol Length: 4824 Sequence: ATGATTGCGGAGCCCGCTCACTTTTACCTGTTTGGATTAATATGTCTCTGTTCAGGCTCCCGTCTTCGTCAGGAAGATTTTCCACCTCGCATTGTTGAACACCCTTCAGACCTGATTGTCTCAAAAGGAGAACCTGCAACTTTGAACTGCAAAGCTGAAGGCCGCCCCACACCCA Show more
Description: A cloning plasmid for the ROBO1 gene.

Anti-Robo1 (1F8)
YF-MA15223	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Robo1

Anti-Robo1 (2G6)
YF-MA10787	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Robo1

Anti-ROBO1 / DUTT1 (Internal) antibody
STJ70835	St John's Laboratory	100 µg	EUR 359

Anti-Robo1 / DUTT1 (mouse) antibody
STJ71019	St John's Laboratory	100 µg	EUR 359

Roundabout Guidance Receptor 1 (ROBO1) Antibody
20-abx124241	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
20-abx115338	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
20-abx121212	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
20-abx218334	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
abx340092-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
20-abx316687	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody
abx430381-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Roundabout Guidance Receptor 1 (Robo1) Antibody
abx430382-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Rat ROBO1 shRNA Plasmid
20-abx985932	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ROBO1 ELISA KIT|Human
EF002538	Lifescience Market	96 Tests	EUR 689

Human ROBO1 shRNA Plasmid
20-abx954100	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ROBO1 shRNA Plasmid
20-abx972473	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Monoclonal ROBO1 Antibody (monoclonal) (M01), Clone: 2G6
AMM04033G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human ROBO1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G6. This antibody is applicable in WB, E

Roundabout Guidance Receptor 1 (ROBO1) Antibody (HRP)
20-abx316688	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody (FITC)
20-abx316689	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Roundabout Guidance Receptor 1 (ROBO1) Antibody (Biotin)
20-abx316690	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human ROBO1 PicoKine ELISA Kit
EK1755	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human ROBO1 in cell culture supernates, serum and plasma (heparin).

Mouse Roundabout homolog 1 (Robo1)
1-CSB-YP020054MO	Cusabio	EUR 586.00 EUR 299.00 EUR 2172.00 EUR 900.00 EUR 1442.00 EUR 382.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 82 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Roundabout homolog 1(Robo1),partial expressed in Yeast

Mouse Roundabout homolog 1 (Robo1)
1-CSB-MP020054MO	Cusabio	EUR 293.00 EUR 963.00 EUR 409.00 EUR 717.00	100ug 1MG 200ug 500ug
MW: 84 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Roundabout homolog 1(Robo1) ,partial expressed in Mammalian cell

Robo1 ORF Vector (Mouse) (pORF)
ORF056258	ABM	1.0 ug DNA	EUR 1572

Robo1 ORF Vector (Rat) (pORF)
ORF075499	ABM	1.0 ug DNA	EUR 2080

ROBO1 ORF Vector (Human) (pORF)
ORF014327	ABM	1.0 ug DNA	EUR 354

pCR-BluntII-TOPO-ROBO1 Plasmid
PVTB00489	Lifescience Market	2 ug	EUR 356

ROBO1 ELISA Kit (Human) (OKAN06046)
OKAN06046	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.116 ng/mL

ROBO1 ELISA Kit (Human) (OKBB01215)
OKBB01215	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Roundabout homolog 1 is a protein that in humans is encoded by the ROBO1 gene. This gene is mapped to 3p12.3. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

ROBO1 ELISA Kit (Human) (OKCD09357)
OKCD09357	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.116ng/mL

ROBO1 ELISA Kit (Human) (OKEH03325)
OKEH03325	Aviva Systems Biology	96 Wells	EUR 727
Description: Description of target: Receptor for SLIT1 and SLIT2 that mediates cellular responses to molecular guidance cues in cellular migration, including axonal navigation at the ventral midline of the neural tube and projection of axons to different regions during neuronal development (PubMed:10102268, PubMed:24560577). Interaction with the intracellular domain of FLRT3 mediates axon attraction towards cells expressing NTN1 (PubMed:24560577). In axon growth cones, the silencing of the attractive effect of NTN1 by SLIT2 may require the formation of a ROBO1-DCC complex. Plays a role in the regulation of cell migration via its interaction with MYO9B; inhibits MYO9B-mediated stimulation of RHOA GTPase activity, and thereby leads to increased levels of active, GTP-bound RHOA (PubMed:26529257). May be required for lung development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.081 ng/mL

ROBO1 Rabbit Polyclonal Antibody