ROBO1 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
ROBO1 Polyclonal Antibody |
ABP60226-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ROBO1 protein at amino acid sequence of 730-810
- Applications tips:
|
Description: A polyclonal antibody for detection of ROBO1 from Human, Mouse, Rat. This ROBO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ROBO1 protein at amino acid sequence of 730-810 |
ROBO1 Polyclonal Antibody |
ABP60226-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ROBO1 protein at amino acid sequence of 730-810
- Applications tips:
|
Description: A polyclonal antibody for detection of ROBO1 from Human, Mouse, Rat. This ROBO1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ROBO1 protein at amino acid sequence of 730-810 |
ROBO1 Rabbit pAb |
A15313-100ul |
Abclonal |
100 ul |
EUR 308 |
ROBO1 Rabbit pAb |
A15313-200ul |
Abclonal |
200 ul |
EUR 459 |
ROBO1 Rabbit pAb |
A15313-20ul |
Abclonal |
20 ul |
EUR 183 |
ROBO1 Rabbit pAb |
A15313-50ul |
Abclonal |
50 ul |
EUR 223 |
ROBO1 Rabbit pAb |
A19506-100ul |
Abclonal |
100 ul |
Ask for price |
ROBO1 Rabbit pAb |
A19506-200ul |
Abclonal |
200 ul |
Ask for price |
ROBO1 Rabbit pAb |
A19506-20ul |
Abclonal |
20 ul |
Ask for price |
ROBO1 Rabbit pAb |
A19506-50ul |
Abclonal |
50 ul |
EUR 308 |
ROBO1 Rabbit pAb |
A9412-100ul |
Abclonal |
100 ul |
EUR 308 |
ROBO1 Rabbit pAb |
A9412-200ul |
Abclonal |
200 ul |
EUR 459 |
ROBO1 Rabbit pAb |
A9412-20ul |
Abclonal |
20 ul |
EUR 183 |
ROBO1 Rabbit pAb |
A9412-50ul |
Abclonal |
50 ul |
Ask for price |
Polyclonal ROBO1 Antibody (Internal) |
APG01042G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ROBO1 (Internal). This antibody is tested and proven to work in the following applications: |
Polyclonal ROBO1 Antibody (Internal) |
APG01234G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ROBO1 (Internal). This antibody is tested and proven to work in the following applications: |
ROBO1 antibody |
70R-21676 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal ROBO1 antibody |
ROBO1 Antibody |
46218-100ul |
SAB |
100ul |
EUR 252 |
ROBO1 Antibody |
46218-50ul |
SAB |
50ul |
EUR 187 |
ROBO1 Antibody |
DF9877 |
Affbiotech |
200ul |
EUR 304 |
Description: ROBO1 Antibody detects endogenous levels of total ROBO1. |
ROBO1 Antibody |
1-CSB-PA896760LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
ROBO1 Antibody |
1-CSB-PA020054GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal ROBO1 Antibody (aa1632-1644) |
APR02181G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ROBO1 (aa1632-1644). This antibody is tested and proven to work in the following applications: |
ROBO1 Conjugated Antibody |
C46218 |
SAB |
100ul |
EUR 397 |
ROBO1-Specific Antibody |
abx237372-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Anti-ROBO1 Antibody |
A01530-2 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-ROBO1 antibody |
STJ11100699 |
St John's Laboratory |
50 µl |
EUR 287 |
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-ROBO1 antibody |
STJ111690 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-ROBO1 antibody |
STJ117508 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-ROBO1 antibody |
STJ191349 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ROBO1 |
Polyclonal Goat Anti-ROBO1 / DUTT1 (Internal) Antibody |
APG00285G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ROBO1 / DUTT1 (Internal) . This antibody is tested and proven to work in the following applications: |
ROBO1 siRNA |
20-abx904630 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ROBO1 siRNA |
20-abx931831 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ROBO1 siRNA |
20-abx931832 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-Robo1 |
YF-PA24590 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to Robo1 |
anti- ROBO1-Specific antibody |
FNab07372 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500-1:2000
- Immunogen: roundabout, axon guidance receptor, homolog 1(Drosophila)
- Uniprot ID: Q9Y6N7
- Research Area: Neuroscience, Immunology, Cardiovascular, Developmental biology
|
Description: Antibody raised against ROBO1-Specific |
Anti-ROBO1/DUTT1 Antibody |
A01530 |
BosterBio |
100ug/200ul |
EUR 397 |
Description: Goat Polyclonal ROBO1/DUTT1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
ROBO1 Antibody, HRP conjugated |
1-CSB-PA896760LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ROBO1 Antibody, FITC conjugated |
1-CSB-PA896760LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ROBO1 Antibody, Biotin conjugated |
1-CSB-PA896760LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against ROBO1. Recognizes ROBO1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ROBO1 Blocking Peptide |
20-abx161212 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ROBO1 Blocking Peptide |
DF9877-BP |
Affbiotech |
1mg |
EUR 195 |
ROBO1 cloning plasmid |
CSB-CL896760HU-10ug |
Cusabio |
10ug |
EUR 1876 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4824
- Sequence: ATGATTGCGGAGCCCGCTCACTTTTACCTGTTTGGATTAATATGTCTCTGTTCAGGCTCCCGTCTTCGTCAGGAAGATTTTCCACCTCGCATTGTTGAACACCCTTCAGACCTGATTGTCTCAAAAGGAGAACCTGCAACTTTGAACTGCAAAGCTGAAGGCCGCCCCACACCCA
- Show more
|
Description: A cloning plasmid for the ROBO1 gene. |
Anti-Robo1 (1F8) |
YF-MA15223 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Robo1 |
Anti-Robo1 (2G6) |
YF-MA10787 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Robo1 |
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
20-abx124241 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
20-abx115338 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
20-abx121212 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
20-abx218334 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
abx340092-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
20-abx316687 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody |
abx430381-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Roundabout Guidance Receptor 1 (Robo1) Antibody |
abx430382-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Rat ROBO1 shRNA Plasmid |
20-abx985932 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human ROBO1 shRNA Plasmid |
20-abx954100 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ROBO1 shRNA Plasmid |
20-abx972473 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Monoclonal ROBO1 Antibody (monoclonal) (M01), Clone: 2G6 |
AMM04033G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human ROBO1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2G6. This antibody is applicable in WB, E |
Roundabout Guidance Receptor 1 (ROBO1) Antibody (HRP) |
20-abx316688 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody (FITC) |
20-abx316689 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Roundabout Guidance Receptor 1 (ROBO1) Antibody (Biotin) |
20-abx316690 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human ROBO1 PicoKine ELISA Kit |
EK1755 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human ROBO1 in cell culture supernates, serum and plasma (heparin). |
Mouse Roundabout homolog 1 (Robo1) |
1-CSB-YP020054MO |
Cusabio |
-
EUR 586.00
-
EUR 299.00
-
EUR 2172.00
-
EUR 900.00
-
EUR 1442.00
-
EUR 382.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 82 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Roundabout homolog 1(Robo1),partial expressed in Yeast |
Mouse Roundabout homolog 1 (Robo1) |
1-CSB-MP020054MO |
Cusabio |
-
EUR 293.00
-
EUR 963.00
-
EUR 409.00
-
EUR 717.00
|
|
- MW: 84 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Roundabout homolog 1(Robo1) ,partial expressed in Mammalian cell |
Robo1 ORF Vector (Mouse) (pORF) |
ORF056258 |
ABM |
1.0 ug DNA |
EUR 1572 |
Robo1 ORF Vector (Rat) (pORF) |
ORF075499 |
ABM |
1.0 ug DNA |
EUR 2080 |
ROBO1 ORF Vector (Human) (pORF) |
ORF014327 |
ABM |
1.0 ug DNA |
EUR 354 |
ROBO1 ELISA Kit (Human) (OKAN06046) |
OKAN06046 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.116 ng/mL |
ROBO1 ELISA Kit (Human) (OKBB01215) |
OKBB01215 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Roundabout homolog 1 is a protein that in humans is encoded by the ROBO1 gene. This gene is mapped to 3p12.3. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
ROBO1 ELISA Kit (Human) (OKCD09357) |
OKCD09357 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Bilateral symmetric nervous systems have special midline structures that establish a partition between the two mirror image halves. Some axons project toward and across the midline in response to long-range chemoattractants emanating from the midline. The product of this gene is a member of the immunoglobulin gene superfamily and encodes an integral membrane protein that functions in axon guidance and neuronal precursor cell migration. This receptor is activated by SLIT-family proteins, resulting in a repulsive effect on glioma cell guidance in the developing brain. A related gene is located at an adjacent region on chromosome 3. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.116ng/mL |
ROBO1 ELISA Kit (Human) (OKEH03325) |
OKEH03325 |
Aviva Systems Biology |
96 Wells |
EUR 727 |
Description: Description of target: Receptor for SLIT1 and SLIT2 that mediates cellular responses to molecular guidance cues in cellular migration, including axonal navigation at the ventral midline of the neural tube and projection of axons to different regions during neuronal development (PubMed:10102268, PubMed:24560577). Interaction with the intracellular domain of FLRT3 mediates axon attraction towards cells expressing NTN1 (PubMed:24560577). In axon growth cones, the silencing of the attractive effect of NTN1 by SLIT2 may require the formation of a ROBO1-DCC complex. Plays a role in the regulation of cell migration via its interaction with MYO9B; inhibits MYO9B-mediated stimulation of RHOA GTPase activity, and thereby leads to increased levels of active, GTP-bound RHOA (PubMed:26529257). May be required for lung development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.081 ng/mL |
ROBO1 Rabbit Polyclonal Antibody