SH2B3 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
SH2B3 Polyclonal Antibody |
ABP60389-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human SH2B3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SH2B3 from Human. This SH2B3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SH2B3 protein |
SH2B3 Polyclonal Antibody |
ABP60389-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human SH2B3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SH2B3 from Human. This SH2B3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SH2B3 protein |
SH2B3 Polyclonal Antibody |
ABP60389-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human SH2B3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of SH2B3 from Human. This SH2B3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SH2B3 protein |
SH2B3 Antibody |
46231-100ul |
SAB |
100ul |
EUR 252 |
SH2B3 Antibody |
46231-50ul |
SAB |
50ul |
EUR 187 |
SH2B3 antibody |
10R-7180 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal SH2B3 antibody |
SH2B3 antibody |
10R-5756 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal SH2B3 antibody |
SH2B3 antibody |
10R-5757 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal SH2B3 antibody |
SH2B3 antibody |
10R-5758 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal SH2B3 antibody |
SH2B3 Antibody |
DF9898 |
Affbiotech |
200ul |
EUR 304 |
Description: SH2B3 Antibody detects endogenous levels of total SH2B3. |
Polyclonal Goat Anti-LNK / SH2B3 Antibody |
APR16324G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LNK / SH2B3 . This antibody is tested and proven to work in the following applications: |
SH2B3 Conjugated Antibody |
C46231 |
SAB |
100ul |
EUR 397 |
Anti-SH2B3 antibody |
STJ191400 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SH2B3 |
SH2B3 siRNA |
20-abx904906 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SH2B3 siRNA |
20-abx933198 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SH2B3 siRNA |
20-abx933199 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SH2B3 Blocking Peptide |
DF9898-BP |
Affbiotech |
1mg |
EUR 195 |
SH2B3 cloning plasmid |
CSB-CL892371HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 156
- Sequence: atggagtttctcttgtcaaccgggctggagtgcagtggtgcaatcttggctcactgcaacctccaccttcctggttcaagcgattctgcctcgacctctcaagtagctgggattacaagcaccagccaccatgcctggctaattttgtatttttag
|
Description: A cloning plasmid for the SH2B3 gene. |
Rabbit Anti-Mouse lymphocyte specific adaptor protein Lnk (SH2B3) (SH2B3- phospho) IgG (aff pure) |
AB-23116-A |
Alpha Diagnostics |
100ug |
EUR 482 |
Rabbit Anti-Mouse lymphocyte specific adaptor protein Lnk (SH2B3) (SH2B3- phospho) IgG (aff pure) |
AB-23117-A |
Alpha Diagnostics |
100ug |
EUR 482 |
Rat SH2B3 shRNA Plasmid |
20-abx985908 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SH2B3 shRNA Plasmid |
20-abx956746 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse SH2B3 shRNA Plasmid |
20-abx971341 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SH2B3 Recombinant Protein (Human) |
RP028411 |
ABM |
100 ug |
Ask for price |
SH2B3 Recombinant Protein (Rat) |
RP228512 |
ABM |
100 ug |
Ask for price |
SH2B3 Recombinant Protein (Mouse) |
RP171563 |
ABM |
100 ug |
Ask for price |
SH2B Adapter Protein 3 (SH2B3) Antibody |
20-abx218561 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SH2B Adapter Protein 3 (SH2B3) Antibody |
abx430033-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Mouse lymphocyte specific adaptor protein Lnk (SH2B3) control (SH2B3- phosphor) peptide |
AB-23116-P |
Alpha Diagnostics |
100ug |
EUR 164 |
Mouse lymphocyte specific adaptor protein Lnk (SH2B3) control (SH2B3- phosphor) peptide |
AB-23117-P |
Alpha Diagnostics |
100ug |
EUR 164 |
SH2B3 ORF Vector (Human) (pORF) |
ORF009471 |
ABM |
1.0 ug DNA |
EUR 95 |
Sh2b3 ORF Vector (Mouse) (pORF) |
ORF057189 |
ABM |
1.0 ug DNA |
EUR 506 |
Sh2b3 ORF Vector (Rat) (pORF) |
ORF076172 |
ABM |
1.0 ug DNA |
EUR 506 |
SH2B3 sgRNA CRISPR Lentivector set (Human) |
K2138601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sh2b3 sgRNA CRISPR Lentivector set (Mouse) |
K3414601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Sh2b3 sgRNA CRISPR Lentivector set (Rat) |
K6852901 |
ABM |
3 x 1.0 ug |
EUR 339 |
SH2B3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2138602 |
ABM |
1.0 ug DNA |
EUR 154 |
SH2B3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2138603 |
ABM |
1.0 ug DNA |
EUR 154 |
SH2B3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2138604 |
ABM |
1.0 ug DNA |
EUR 154 |
Sh2b3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3414602 |
ABM |
1.0 ug DNA |
EUR 154 |
Sh2b3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3414603 |
ABM |
1.0 ug DNA |
EUR 154 |
Sh2b3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3414604 |
ABM |
1.0 ug DNA |
EUR 154 |
Sh2b3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6852902 |
ABM |
1.0 ug DNA |
EUR 154 |
Sh2b3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6852903 |
ABM |
1.0 ug DNA |
EUR 154 |
Sh2b3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6852904 |
ABM |
1.0 ug DNA |
EUR 154 |
SH2B3 Protein Vector (Human) (pPB-C-His) |
PV037881 |
ABM |
500 ng |
EUR 329 |
SH2B3 Protein Vector (Human) (pPB-N-His) |
PV037882 |
ABM |
500 ng |
EUR 329 |
SH2B3 Protein Vector (Human) (pPM-C-HA) |
PV037883 |
ABM |
500 ng |
EUR 329 |
SH2B3 Protein Vector (Human) (pPM-C-His) |
PV037884 |
ABM |
500 ng |
EUR 329 |
SH2B3 Protein Vector (Rat) (pPB-C-His) |
PV304686 |
ABM |
500 ng |
EUR 603 |
SH2B3 Protein Vector (Rat) (pPB-N-His) |
PV304687 |
ABM |
500 ng |
EUR 603 |
SH2B3 Protein Vector (Rat) (pPM-C-HA) |
PV304688 |
ABM |
500 ng |
EUR 603 |
SH2B3 Protein Vector (Rat) (pPM-C-His) |
PV304689 |
ABM |
500 ng |
EUR 603 |
SH2B3 Protein Vector (Mouse) (pPB-C-His) |
PV228754 |
ABM |
500 ng |
EUR 603 |
SH2B3 Protein Vector (Mouse) (pPB-N-His) |
PV228755 |
ABM |
500 ng |
EUR 603 |
SH2B3 Protein Vector (Mouse) (pPM-C-HA) |
PV228756 |
ABM |
500 ng |
EUR 603 |
SH2B3 Protein Vector (Mouse) (pPM-C-His) |
PV228757 |
ABM |
500 ng |
EUR 603 |
Sh2b3 3'UTR GFP Stable Cell Line |
TU168736 |
ABM |
1.0 ml |
Ask for price |
SH2B3 3'UTR Luciferase Stable Cell Line |
TU023083 |
ABM |
1.0 ml |
EUR 2333 |
Sh2b3 3'UTR Luciferase Stable Cell Line |
TU118736 |
ABM |
1.0 ml |
Ask for price |
SH2B3 3'UTR GFP Stable Cell Line |
TU073083 |
ABM |
1.0 ml |
EUR 2333 |
Sh2b3 3'UTR Luciferase Stable Cell Line |
TU220281 |
ABM |
1.0 ml |
Ask for price |
Sh2b3 3'UTR GFP Stable Cell Line |
TU270281 |
ABM |
1.0 ml |
Ask for price |
Mouse SH2B adapter protein 3, Sh2b3 ELISA KIT |
ELI-19210m |
Lifescience Market |
96 Tests |
EUR 865 |
Human SH2B adapter protein 3, SH2B3 ELISA KIT |
ELI-36064h |
Lifescience Market |
96 Tests |
EUR 824 |
SH2B3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV692845 |
ABM |
1.0 ug DNA |
EUR 682 |
SH2B3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV692849 |
ABM |
1.0 ug DNA |
EUR 682 |
SH2B3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV692850 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
SH2B3 Rabbit Polyclonal Antibody