SPDEF Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
SPDEF Polyclonal Antibody |
ES10192-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against SPDEF from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
SPDEF Rabbit pAb |
A14114-100ul |
Abclonal |
100 ul |
EUR 308 |
SPDEF Rabbit pAb |
A14114-200ul |
Abclonal |
200 ul |
EUR 459 |
SPDEF Rabbit pAb |
A14114-20ul |
Abclonal |
20 ul |
EUR 183 |
SPDEF Rabbit pAb |
A14114-50ul |
Abclonal |
50 ul |
EUR 223 |
SPDEF Rabbit pAb |
A6747-100ul |
Abclonal |
100 ul |
EUR 308 |
SPDEF Rabbit pAb |
A6747-200ul |
Abclonal |
200 ul |
EUR 459 |
SPDEF Rabbit pAb |
A6747-20ul |
Abclonal |
20 ul |
EUR 183 |
SPDEF Rabbit pAb |
A6747-50ul |
Abclonal |
50 ul |
EUR 223 |
SPDEF Antibody |
35874-100ul |
SAB |
100ul |
EUR 252 |
SPDEF Antibody |
1-CSB-PA874773 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
SPDEF antibody |
70R-8298 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal SPDEF antibody |
SPDEF Antibody |
1-CSB-PA022518LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
Polyclonal SPDEF antibody - middle region |
APR00614G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPDEF - middle region. This antibody is tested and proven to work in the following applications: |
Polyclonal SPDEF antibody - N-terminal region |
APR00593G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPDEF - N-terminal region. This antibody is tested and proven to work in the following applications: |
SPDEF Conjugated Antibody |
C35874 |
SAB |
100ul |
EUR 397 |
Anti-SPDEF antibody |
STJ28830 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-SPDEF antibody |
STJ116049 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
Anti-SPDEF antibody |
STJ191350 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to SPDEF |
SPDEF siRNA |
20-abx934902 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SPDEF siRNA |
20-abx934903 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-SPDEF |
YF-PA25935 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to SPDEF |
SPDEF Antibody, HRP conjugated |
1-CSB-PA022518LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
SPDEF Antibody, FITC conjugated |
1-CSB-PA022518LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
SPDEF Antibody, Biotin conjugated |
1-CSB-PA022518LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against SPDEF. Recognizes SPDEF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
SPDEF Blocking Peptide |
33R-2949 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SPDEF antibody, catalog no. 70R-8298 |
SPDEF cloning plasmid |
CSB-CL022518HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1008
- Sequence: atgggcagcgccagcccgggtctgagcagcgtatcccccagccacctcctgctgccccccgacacggtgtcgcggacaggcttggagaaggcggcagcgggggcagtgggtctcgagagacgggactggagtcccagtccacccgccacgcccgagcagggcctgtccgccttct
- Show more
|
Description: A cloning plasmid for the SPDEF gene. |
Anti-SPDEF (4A5) |
YF-MA18002 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to SPDEF |
Mouse SPDEF shRNA Plasmid |
20-abx974014 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human SPDEF shRNA Plasmid |
20-abx958507 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
SPDEF Recombinant Protein (Rat) |
RP230720 |
ABM |
100 ug |
Ask for price |
SPDEF Recombinant Protein (Human) |
RP029854 |
ABM |
100 ug |
Ask for price |
SPDEF Recombinant Protein (Mouse) |
RP174884 |
ABM |
100 ug |
Ask for price |
Monoclonal SPDEF Antibody (monoclonal) (M01), Clone: 4A5 |
AMM04127G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human SPDEF (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A5. This antibody is applicable in WB, E |
Spdef ORF Vector (Rat) (pORF) |
ORF076908 |
ABM |
1.0 ug DNA |
EUR 506 |
SPDEF ORF Vector (Human) (pORF) |
ORF009952 |
ABM |
1.0 ug DNA |
EUR 95 |
Spdef ORF Vector (Mouse) (pORF) |
ORF058296 |
ABM |
1.0 ug DNA |
EUR 506 |
SPDEF ELISA Kit (Human) (OKCA01500) |
OKCA01500 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: May function as an androgen-independent transactivator of the prostate-specific antigen (PSA) promoter. Binds to 5'-GGAT-3' DNA sequences. May play a role in the regulation of the prostate gland and/or prostate cancer development. Acts as a transcriptional activator for SERPINB5 promoter.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL |
SPDEF ELISA Kit (Human) (OKEH08557) |
OKEH08557 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.35ng/mL |
SPDEF ELISA Kit (Mouse) (OKEH08558) |
OKEH08558 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.156ng/mL |
Spdef sgRNA CRISPR Lentivector set (Rat) |
K6696201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Spdef sgRNA CRISPR Lentivector set (Mouse) |
K3873401 |
ABM |
3 x 1.0 ug |
EUR 339 |
SPDEF sgRNA CRISPR Lentivector set (Human) |
K2269901 |
ABM |
3 x 1.0 ug |
EUR 339 |
SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody |
20-abx006389 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
SAM pointed domain-containing Ets transcription factor (SPDEF) Antibody |
20-abx212939 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody |
abx145115-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
SAM Pointed Domain-Containing Ets Transcription Factor (SPDEF) Antibody |
20-abx317850 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Spdef sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6696202 |
ABM |
1.0 ug DNA |
EUR 154 |
Spdef sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6696203 |
ABM |
1.0 ug DNA |
EUR 154 |
Spdef sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6696204 |
ABM |
1.0 ug DNA |
EUR 154 |
Spdef sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3873402 |
ABM |
1.0 ug DNA |
EUR 154 |
Spdef sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3873403 |
ABM |
1.0 ug DNA |
EUR 154 |
Spdef sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3873404 |
ABM |
1.0 ug DNA |
EUR 154 |
SPDEF sgRNA CRISPR Lentivector (Human) (Target 1) |
K2269902 |
ABM |
1.0 ug DNA |
EUR 154 |
SPDEF sgRNA CRISPR Lentivector (Human) (Target 2) |
K2269903 |
ABM |
1.0 ug DNA |
EUR 154 |
SPDEF sgRNA CRISPR Lentivector (Human) (Target 3) |
K2269904 |
ABM |
1.0 ug DNA |
EUR 154 |
SPDEF Protein Vector (Rat) (pPB-C-His) |
PV307630 |
ABM |
500 ng |
EUR 603 |
SPDEF Protein Vector (Rat) (pPB-N-His) |
PV307631 |
ABM |
500 ng |
EUR 603 |
SPDEF Protein Vector (Rat) (pPM-C-HA) |
PV307632 |
ABM |
500 ng |
EUR 603 |
SPDEF Protein Vector (Rat) (pPM-C-His) |
PV307633 |
ABM |
500 ng |
EUR 603 |
SPDEF Protein Vector (Human) (pPB-C-His) |
PV039805 |
ABM |
500 ng |
EUR 329 |
SPDEF Protein Vector (Human) (pPB-N-His) |
PV039806 |
ABM |
500 ng |
EUR 329 |
SPDEF Protein Vector (Human) (pPM-C-HA) |
PV039807 |
ABM |
500 ng |
EUR 329 |
SPDEF Protein Vector (Human) (pPM-C-His) |
PV039808 |
ABM |
500 ng |
EUR 329 |
SPDEF Protein Vector (Mouse) (pPB-C-His) |
PV233182 |
ABM |
500 ng |
EUR 603 |
SPDEF Protein Vector (Mouse) (pPB-N-His) |
PV233183 |
ABM |
500 ng |
EUR 603 |
SPDEF Protein Vector (Mouse) (pPM-C-HA) |
PV233184 |
ABM |
500 ng |
EUR 603 |
SPDEF Protein Vector (Mouse) (pPM-C-His) |
PV233185 |
ABM |
500 ng |
EUR 603 |
Spdef 3'UTR Luciferase Stable Cell Line |
TU119556 |
ABM |
1.0 ml |
Ask for price |
Spdef 3'UTR GFP Stable Cell Line |
TU169556 |
ABM |
1.0 ml |
Ask for price |
Spdef 3'UTR Luciferase Stable Cell Line |
TU221056 |
ABM |
1.0 ml |
Ask for price |
SPDEF 3'UTR GFP Stable Cell Line |
TU074433 |
ABM |
1.0 ml |
EUR 1394 |
Spdef 3'UTR GFP Stable Cell Line |
TU271056 |
ABM |
1.0 ml |
Ask for price |
SPDEF 3'UTR Luciferase Stable Cell Line |
TU024433 |
ABM |
1.0 ml |
EUR 1394 |
SPDEF Rabbit Polyclonal Antibody