STAC Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
STAC Polyclonal Antibody |
ES10244-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against STAC from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
STAC Polyclonal Antibody |
ABP60530-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human STAC protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STAC from Human, Mouse. This STAC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAC protein |
STAC Polyclonal Antibody |
ABP60530-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STAC protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STAC from Human, Mouse. This STAC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAC protein |
STAC Polyclonal Antibody |
ABP60530-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STAC protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STAC from Human, Mouse. This STAC antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAC protein |
STAC Polyclonal Antibody |
28912-100ul |
SAB |
100ul |
EUR 252 |
STAC Polyclonal Antibody |
28912-50ul |
SAB |
50ul |
EUR 187 |
STAC Rabbit pAb |
A15319-100ul |
Abclonal |
100 ul |
EUR 308 |
STAC Rabbit pAb |
A15319-200ul |
Abclonal |
200 ul |
EUR 459 |
STAC Rabbit pAb |
A15319-20ul |
Abclonal |
20 ul |
EUR 183 |
STAC Rabbit pAb |
A15319-50ul |
Abclonal |
50 ul |
EUR 223 |
STAC Polyclonal Conjugated Antibody |
C28912 |
SAB |
100ul |
EUR 397 |
STAC antibody |
70R-20558 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal STAC antibody |
STAC Antibody |
1-CSB-PA859100LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
STAC Antibody |
1-CSB-PA022782GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against STAC. Recognizes STAC from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal STAC Antibody (C-term) |
APR13560G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAC (C-term). This antibody is tested and proven to work in the following applications: |
anti- STAC antibody |
FNab08278 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: SH3 and cysteine rich domain
- Uniprot ID: Q99469
- Gene ID: 6769
- Research Area: Neuroscience, Signal Transduction
|
Description: Antibody raised against STAC |
Anti-STAC antibody |
STJ191402 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to STAC |
STAC siRNA |
20-abx935365 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STAC siRNA |
20-abx935366 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-STAC |
YF-PA14809 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to STAC |
anti-STAC |
YF-PA14810 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to STAC |
anti-STAC |
YF-PA24778 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to STAC |
STAC Antibody, HRP conjugated |
1-CSB-PA859100LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
STAC Antibody, FITC conjugated |
1-CSB-PA859100LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
STAC Antibody, Biotin conjugated |
1-CSB-PA859100LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STAC. Recognizes STAC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
STAC cloning plasmid |
CSB-CL859100HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1209
- Sequence: atgatccctccgagcagcccccgcgaggacggcgtggacgggctgcccaaggaggcggtgggcgccgagcaaccgccctctcctgcatccaccagcagccaggaatccaagctccagaaactaaaacgatcactttctttcaagaccaagagtttacggagcaaaagtgctgaca
- Show more
|
Description: A cloning plasmid for the STAC gene. |
Anti-STAC (2C5) |
YF-MA15632 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to STAC |
Human STAC shRNA Plasmid |
20-abx954627 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
STAC protein (His tag) |
80R-3877 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant STAC protein (His tag) |
Mouse STAC shRNA Plasmid |
20-abx972900 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
STAC Recombinant Protein (Human) |
RP030271 |
ABM |
100 ug |
Ask for price |
STAC Recombinant Protein (Mouse) |
RP175859 |
ABM |
100 ug |
Ask for price |
Monoclonal STAC Antibody (monoclonal) (M01), Clone: 2C5 |
APR13561G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human STAC (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2C5. This antibody is applicable in WB, E |
SH3 And Cysteine Rich Domain (STAC) Antibody |
abx146127-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
SH3 And Cysteine Rich Domain (STAC) Antibody |
abx030258-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
SH3 And Cysteine Rich Domain (STAC) Antibody |
abx030258-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
SH3 And Cysteine Rich Domain (STAC) Antibody |
abx238278-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
SH3 And Cysteine Rich Domain (STAC) Antibody |
20-abx301039 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Stac ORF Vector (Mouse) (pORF) |
ORF058621 |
ABM |
1.0 ug DNA |
EUR 506 |
STAC ORF Vector (Human) (pORF) |
ORF010091 |
ABM |
1.0 ug DNA |
EUR 95 |
SH3 And Cysteine Rich Domain (STAC) Antibody (HRP) |
20-abx315491 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
SH3 And Cysteine Rich Domain (STAC) Antibody (FITC) |
20-abx315492 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
SH3 And Cysteine Rich Domain (STAC) Antibody (Biotin) |
20-abx315493 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
STAC sgRNA CRISPR Lentivector set (Human) |
K2297801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Stac sgRNA CRISPR Lentivector set (Mouse) |
K4004701 |
ABM |
3 x 1.0 ug |
EUR 339 |
SH3 And Cysteine Rich Domain (STAC) Protein |
20-abx261343 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
STAC sgRNA CRISPR Lentivector (Human) (Target 1) |
K2297802 |
ABM |
1.0 ug DNA |
EUR 154 |
STAC sgRNA CRISPR Lentivector (Human) (Target 2) |
K2297803 |
ABM |
1.0 ug DNA |
EUR 154 |
STAC sgRNA CRISPR Lentivector (Human) (Target 3) |
K2297804 |
ABM |
1.0 ug DNA |
EUR 154 |
Stac sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4004702 |
ABM |
1.0 ug DNA |
EUR 154 |
Stac sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4004703 |
ABM |
1.0 ug DNA |
EUR 154 |
Stac sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4004704 |
ABM |
1.0 ug DNA |
EUR 154 |
STAC Protein Vector (Human) (pPB-C-His) |
PV040361 |
ABM |
500 ng |
EUR 329 |
STAC Protein Vector (Human) (pPB-N-His) |
PV040362 |
ABM |
500 ng |
EUR 329 |
STAC Protein Vector (Human) (pPM-C-HA) |
PV040363 |
ABM |
500 ng |
EUR 329 |
STAC Protein Vector (Human) (pPM-C-His) |
PV040364 |
ABM |
500 ng |
EUR 329 |
Recombinant Human STAC Protein, His, E.coli-1mg |
QP13605-1mg |
EnQuireBio |
1mg |
EUR 2757 |
Recombinant Human STAC Protein, His, E.coli-20ug |
QP13605-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human STAC Protein, His, E.coli-5ug |
QP13605-5ug |
EnQuireBio |
5ug |
EUR 155 |
STAC Protein Vector (Mouse) (pPB-C-His) |
PV234482 |
ABM |
500 ng |
EUR 603 |
STAC Protein Vector (Mouse) (pPB-N-His) |
PV234483 |
ABM |
500 ng |
EUR 603 |
STAC Protein Vector (Mouse) (pPM-C-HA) |
PV234484 |
ABM |
500 ng |
EUR 603 |
STAC Protein Vector (Mouse) (pPM-C-His) |
PV234485 |
ABM |
500 ng |
EUR 603 |
Stac 3'UTR GFP Stable Cell Line |
TU169793 |
ABM |
1.0 ml |
Ask for price |
Stac 3'UTR Luciferase Stable Cell Line |
TU119793 |
ABM |
1.0 ml |
Ask for price |
STAC 3'UTR GFP Stable Cell Line |
TU074758 |
ABM |
1.0 ml |
EUR 1521 |
STAC 3'UTR Luciferase Stable Cell Line |
TU024758 |
ABM |
1.0 ml |
EUR 1521 |
Stac 3'UTR Luciferase Stable Cell Line |
TU221258 |
ABM |
1.0 ml |
Ask for price |
Stac 3'UTR GFP Stable Cell Line |
TU271258 |
ABM |
1.0 ml |
Ask for price |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
STAC Rabbit Polyclonal Antibody