STAR Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
STAR Polyclonal Antibody |
ABP60534-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human STAR protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STAR from Human, Mouse, Rat. This STAR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAR protein |
STAR Polyclonal Antibody |
ABP60534-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STAR protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STAR from Human, Mouse, Rat. This STAR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAR protein |
STAR Polyclonal Antibody |
ABP60534-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STAR protein
- Applications tips:
|
Description: A polyclonal antibody for detection of STAR from Human, Mouse, Rat. This STAR antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STAR protein |
STAR Polyclonal Antibody |
A61174 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit |
DLR-STAR-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Steroidogenic Acute Regulatory Protein (STAR) in samples from tissue homogenates or other biological fluids. |
Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit |
DLR-STAR-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Steroidogenic Acute Regulatory Protein (STAR) in samples from tissue homogenates or other biological fluids. |
Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit |
RD-STAR-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit |
RD-STAR-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit |
RDR-STAR-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Steroidogenic Acute Regulatory Protein (STAR) ELISA Kit |
RDR-STAR-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
STAR Rabbit pAb |
A1035-100ul |
Abclonal |
100 ul |
EUR 308 |
STAR Rabbit pAb |
A1035-200ul |
Abclonal |
200 ul |
EUR 459 |
STAR Rabbit pAb |
A1035-20ul |
Abclonal |
20 ul |
EUR 183 |
STAR Rabbit pAb |
A1035-50ul |
Abclonal |
50 ul |
EUR 223 |
STAR Rabbit pAb |
A16432-100ul |
Abclonal |
100 ul |
EUR 308 |
STAR Rabbit pAb |
A16432-200ul |
Abclonal |
200 ul |
EUR 459 |
STAR Rabbit pAb |
A16432-20ul |
Abclonal |
20 ul |
EUR 183 |
STAR Rabbit pAb |
A16432-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal STAR Antibody (Center) |
APR10929G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAR (Center). This antibody is tested and proven to work in the following applications: |
STAR Polyclonal Antibody, Biotin Conjugated |
A61175 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
STAR Polyclonal Antibody, FITC Conjugated |
A61176 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
STAR Polyclonal Antibody, HRP Conjugated |
A61177 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
STAR Antibody |
43333-100ul |
SAB |
100ul |
EUR 252 |
STAR Antibody |
32129-100ul |
SAB |
100ul |
EUR 252 |
STAR antibody |
22510-100ul |
SAB |
100ul |
EUR 390 |
STAR antibody |
70R-20565 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal STAR antibody |
STAR antibody |
70R-12924 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal STAR antibody |
STAR Antibody |
DF6192 |
Affbiotech |
200ul |
EUR 304 |
Description: STAR Antibody detects endogenous levels of total STAR. |
STAR Antibody |
1-CSB-PA226492 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against STAR. Recognizes STAR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:40-1:150 |
STAR Antibody |
1-CSB-PA174690 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against STAR. Recognizes STAR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
STAR Antibody |
1-CSB-PA022798GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against STAR. Recognizes STAR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
STAR Antibody |
1-CSB-PA022798LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STAR. Recognizes STAR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
STAR Conjugated Antibody |
C43333 |
SAB |
100ul |
EUR 397 |
STAR Conjugated Antibody |
C32129 |
SAB |
100ul |
EUR 397 |
anti- STAR antibody |
FNab08288 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:2000
- IHC: 1:20-1:200
- Immunogen: steroidogenic acute regulatory protein
- Uniprot ID: P49675
- Gene ID: 6770
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against STAR |
Anti-StAR Antibody |
A00051-1 |
BosterBio |
100ug/vial |
EUR 294 |
Human STAR Antibody |
32172-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-STAR antibody |
STJ25713 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13. |
Anti-STAR antibody |
STJ191473 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to STAR |
STAR siRNA |
20-abx905318 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STAR siRNA |
20-abx935404 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STAR siRNA |
20-abx935405 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
WESTSAVE STAR |
LF-QC0106 |
Abfrontier |
1kit |
EUR 171 |
Description: Abfrontier WESTSAVE STARTM (Western Blotting Substrate) is enhanced luminol-based chemiluminescent
substrate for the non-radioactive detection of Horseradish Peroxidase(HRP) labeled antibodies. |
WESTSAVE STAR |
LF-QC0107 |
Abfrontier |
1kit(Double pack) |
EUR 270 |
Description: Abfrontier WESTSAVE STARTM (Western Blotting Substrate) is enhanced luminol-based chemiluminescent
substrate for the non-radioactive detection of Horseradish Peroxidase(HRP) labeled antibodies. |
WESTSAVE STAR |
LF-QC0108 |
Abfrontier |
1kit (200 ml) |
EUR 270 |
Description: Abfrontier WESTSAVE STARTM (Western Blotting Substrate) is enhanced luminol-based chemiluminescent
substrate for the non-radioactive detection of Horseradish Peroxidase(HRP) labeled antibodies. |
STAR Antibody, HRP conjugated |
1-CSB-PA022798LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STAR. Recognizes STAR from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
STAR Antibody, FITC conjugated |
1-CSB-PA022798LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STAR. Recognizes STAR from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
STAR Antibody, Biotin conjugated |
1-CSB-PA022798LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against STAR. Recognizes STAR from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC552140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF555 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC552140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF555 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC552154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF555 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC552154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF555 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC612140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF660R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC612140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF660R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC612154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF660R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC612154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF660R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC402140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF640R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC402140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF640R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC402154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF640R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC402154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF640R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC472140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF647 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC472140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF647 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC472154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF647 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC472154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF647 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC052140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF405M conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC052140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF405M conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC052154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF405M conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC052154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF405M conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC042140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF405S conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC042140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF405S conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC042154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF405S conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC042154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF405S conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC432140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF543 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC432140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF543 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC432154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF543 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC432154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF543 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNUB2140-100 |
Biotium |
100uL |
EUR 264 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Concentration: 0.2mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNUB2140-50 |
Biotium |
50uL |
EUR 405 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), 1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNUB2140-500 |
Biotium |
500uL |
EUR 513 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Concentration: 0.2mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNUB2154-100 |
Biotium |
100uL |
EUR 264 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Concentration: 0.2mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNUB2154-50 |
Biotium |
50uL |
EUR 405 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), 1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNUB2154-500 |
Biotium |
500uL |
EUR 513 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Concentration: 0.2mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC682140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF568 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC682140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF568 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC682154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF568 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC682154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF568 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC702140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF770 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC702140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF770 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC702154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF770 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC702154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF770 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC882140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF488A conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC882140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF488A conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC882154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF488A conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC882154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF488A conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC942140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF594 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC942140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF594 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC942154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF594 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC942154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF594 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNCB2140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Biotin conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNCB2140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Biotin conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNCB2154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Biotin conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNCB2154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Biotin conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNCH2140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNCH2140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNCH2154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNCH2154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC802140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF680 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC802140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF680 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC802154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF680 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC802154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF680 conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNCP2140-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), PerCP conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNCP2154-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), PerCP conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNCA2140-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), APC conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNCA2154-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), APC conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNCAP2140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNCAP2140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNCAP2154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNCAP2154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC812140-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF680R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNC812140-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), CF680R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC812154-100 |
Biotium |
100uL |
EUR 233 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF680R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNC812154-500 |
Biotium |
500uL |
EUR 545 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), CF680R conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140) Antibody |
BNCR2140-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2140), RPE conjugate, Concentration: 0.1mg/mL |
StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154) Antibody |
BNCR2154-250 |
Biotium |
250uL |
EUR 394 |
Description: Primary antibody against StAR (Steroidogenic Acute Regulator) (Leydig Cell Marker) (STAR/2154), RPE conjugate, Concentration: 0.1mg/mL |
Human STAR Antibody (Biotin Conjugate) |
32172-05121 |
AssayPro |
150 ug |
EUR 369 |
StAR MonoSpecific Antibody, Unconjugated-20ug |
6770-MSM3-P0 |
EnQuireBio |
20ug |
EUR 233 |
StAR MonoSpecific Antibody, Unconjugated-100ug |
6770-MSM3-P1 |
EnQuireBio |
100ug |
EUR 428 |
STAR cloning plasmid |
CSB-CL022798HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 858
- Sequence: atgctgctagcgacattcaagctgtgcgctgggagctcctacagacacatgcgcaacatgaaggggctgaggcaacaggctgtgatggccatcagccaggagctgaaccggagggccctggggggccccacccctagcacgtggattaaccaggttcggcggcggagctctctact
- Show more
|
Description: A cloning plasmid for the STAR gene. |
STAR Blocking Peptide |
DF6192-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-StAR (5F9) |
YF-MA15633 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to StAR |
Anti-StAR (2B5) |
YF-MA15634 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to StAR |
Anti-StAR (5F9) |
YF-MA10885 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to StAR |
StAR-related lipid transfer protein 7, mitochondrial Polyclonal Antibody |
42392-100ul |
SAB |
100ul |
EUR 333 |
StAR-related lipid transfer protein 7, mitochondrial Polyclonal Conjugated Antibody |
C42392 |
SAB |
100ul |
EUR 397 |
Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig) |
4-PAG512Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STAR (Met1~Cys285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR) |
Steroidogenic Acute Regulatory Protein (STAR) Antibody |
20-abx115857 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Steroidogenic Acute Regulatory Protein (STAR) Antibody |
20-abx129239 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Steroidogenic Acute Regulatory Protein (STAR) Antibody |
20-abx174649 |
Abbexa |
|
|
|
Steroidogenic Acute Regulatory Protein (STAR) Antibody |
20-abx214068 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Steroidogenic Acute Regulatory Protein (STAR) Antibody |
20-abx214530 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human STAR AssayLite Antibody (FITC Conjugate) |
32172-05141 |
AssayPro |
150 ug |
EUR 428 |
Human STAR AssayLite Antibody (RPE Conjugate) |
32172-05151 |
AssayPro |
150 ug |
EUR 428 |
Human STAR AssayLite Antibody (APC Conjugate) |
32172-05161 |
AssayPro |
150 ug |
EUR 428 |
Human STAR AssayLite Antibody (PerCP Conjugate) |
32172-05171 |
AssayPro |
150 ug |
EUR 471 |
Rat STAR shRNA Plasmid |
20-abx985119 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human STAR shRNA Plasmid |
20-abx954628 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
STAR protein (His tag) |
80R-2034 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Recombinant human STAR protein (His tag) |
Mouse STAR shRNA Plasmid |
20-abx972905 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
STAR Recombinant Protein (Human) |
RP030313 |
ABM |
100 ug |
Ask for price |
STAR Recombinant Protein (Rat) |
RP231326 |
ABM |
100 ug |
Ask for price |
STAR Recombinant Protein (Mouse) |
RP175898 |
ABM |
100 ug |
Ask for price |
Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), APC |
4-PAG512Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STAR (Met1~Cys285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with APC. |
Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), Biotinylated |
4-PAG512Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STAR (Met1~Cys285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with Biotin. |
Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), Cy3 |
4-PAG512Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STAR (Met1~Cys285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with Cy3. |
Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), FITC |
4-PAG512Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STAR (Met1~Cys285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with FITC. |
Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), HRP |
4-PAG512Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STAR (Met1~Cys285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with HRP. |
Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), PE |
4-PAG512Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STAR (Met1~Cys285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with PE. |
Monoclonal STAR Antibody (monoclonal) (M01), Clone: 5F9 |
APR10253G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human STAR (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5F9. This antibody is applicable in WB, E |
RNA-Binding Protein T-Star (KHDRBS3) Antibody |
20-abx113355 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody |
20-abx000970 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody |
20-abx142247 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody |
abx145266-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
RNA-Binding Protein T-Star (KHDRBS3) Antibody |
20-abx005088 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
RNA-Binding Protein T-Star (KHDRBS3) Antibody |
abx030741-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
RNA-Binding Protein T-Star (KHDRBS3) Antibody |
abx030741-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody |
abx028894-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody |
abx028894-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
RNA-Binding Protein T-Star (KHDRBS3) Antibody |
20-abx320740 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
RNA-Binding Protein T-Star (KHDRBS3) Antibody |
abx218434-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody |
abx238288-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
RNA-Binding Protein T-Star (KHDRBS3) Antibody |
abx234523-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody |
20-abx301292 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Star 1kb DNA Ladder Express |
BT10701 |
Bioatlas |
500µl |
EUR 80 |
Description: High purity buffer for various PCR applications. |
Star ORF Vector (Mouse) (pORF) |
ORF058634 |
ABM |
1.0 ug DNA |
EUR 1572 |
STAR ORF Vector (Human) (pORF) |
ORF010105 |
ABM |
1.0 ug DNA |
EUR 95 |
Star ORF Vector (Rat) (pORF) |
ORF077110 |
ABM |
1.0 ug DNA |
EUR 506 |
STAR ELISA Kit (Human) (OKCD00508) |
OKCD00508 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Plays a key role in steroid hormone synthesis by enhancing the metabolism of cholesterol into pregnenolone. Mediates the transfer of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane where it is cleaved to pregnenolone. <p>Describes the metabolic pathway(s) associated with a protein.</p><p><a href='../manual/pathway' target='_top'>More...</a></p>Pathwayi: cholesterol metabolismThis protein is involved in the pathway cholesterol metabolism, which is part of Steroid metabolism._x005F_x005F_x000D_View all proteins of this organism that are known to be involved in the pathway cholesterol metabolism and in Steroid metabolism. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.064 ng/mL |
STAR ELISA Kit (Human) (OKDD00547) |
OKDD00547 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.064 ng/mL |
STAR ELISA Kit (Rat) (OKEH03717) |
OKEH03717 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Plays a key role in steroid hormone synthesis by enhancing the metabolism of cholesterol into pregnenolone. Mediates the transfer of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane where it is cleaved to pregnenolone. <p>Describes the metabolic pathway(s) associated with a protein.</p><p><a href='../manual/pathway' target='_top'>More...</a></p>Pathwayi: cholesterol metabolismThis protein is involved in the pathway cholesterol metabolism, which is part of Steroid metabolism. View all proteins of this organism that are known to be involved in the pathway cholesterol metabolism and in Steroid metabolism.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.182 ng/mL |
STAR ELISA Kit (Human) (OKEH08162) |
OKEH08162 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: The protein encoded by this gene plays a key role in the acute regulation of steroid hormone synthesis by enhancing the conversion of cholesterol into pregnenolone. This protein permits the cleavage of cholesterol into pregnenolone by mediating the transport of cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane. Mutations in this gene are a cause of congenital lipoid adrenal hyperplasia (CLAH), also called lipoid CAH. A pseudogene of this gene is located on chromosome 13.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Steroidogenic Acute Regulatory Protein (STAR) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7 |
4-PAG512Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: STAR (Met1~Cys285)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Steroidogenic Acute Regulatory Protein (STAR). This antibody is labeled with APC-Cy7. |
StAR-Related Lipid Transfer Protein 4 (STARD4) Antibody |
abx036005-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
StAR-Related Lipid Transfer Protein 13 (STARD13) Antibody |
abx031158-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
StAR-Related Lipid Transfer Protein 13 (STARD13) Antibody |
abx031158-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
StAR-Related Lipid Transfer Protein 6 (STARD6) Antibody |
abx026468-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
StAR-Related Lipid Transfer Protein 6 (STARD6) Antibody |
abx026468-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
StAR-Related Lipid Transfer Protein 13 (STA13) Antibody |
20-abx013866 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
StAR-related lipid transfer protein 13 (STARD13) Antibody |
20-abx325729 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
StAR-related lipid transfer protein 13 (STARD13) Antibody |
abx330528-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody (HRP) |
20-abx305445 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Steroidogenic Acute Regulatory Protein, Mitochondrial (STAR) Antibody (FITC) |
20-abx305446 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
STAR Rabbit Polyclonal Antibody