STK40 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
STK40 Polyclonal Antibody |
ES10205-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against STK40 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
STK40 Polyclonal Antibody |
ABP60545-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of STK40 from Human, Mouse, Rat. This STK40 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110 |
STK40 Polyclonal Antibody |
ABP60545-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of STK40 from Human, Mouse, Rat. This STK40 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110 |
STK40 Polyclonal Antibody |
ABP60545-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110
- Applications tips:
|
Description: A polyclonal antibody for detection of STK40 from Human, Mouse, Rat. This STK40 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STK40 protein at amino acid sequence of 30-110 |
STK40 Antibody |
36201-100ul |
SAB |
100ul |
EUR 252 |
STK40 antibody |
70R-13420 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal STK40 antibody |
STK40 Antibody |
1-CSB-PA158011 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against STK40. Recognizes STK40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200 |
STK40 Antibody |
1-CSB-PA112765 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against STK40. Recognizes STK40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200 |
Polyclonal STK40 Antibody ( C-term ) |
APR06136G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STK40 ( C-term ). This antibody is tested and proven to work in the following applications: |
STK40 Conjugated Antibody |
C36201 |
SAB |
100ul |
EUR 397 |
Anti-STK40 antibody |
STJ191363 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to STK40 |
STK40 siRNA |
20-abx905335 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STK40 siRNA |
20-abx935491 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
STK40 siRNA |
20-abx935492 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-STK40 |
YF-PA21285 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to STK40 |
anti-STK40 |
YF-PA21286 |
Abfrontier |
100 ul |
EUR 403 |
Description: Rabbit polyclonal to STK40 |
anti-STK40 |
YF-PA26700 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to STK40 |
STK40 cloning plasmid |
CSB-CL854027HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 702
- Sequence: atggtgctcaacaagaggacacatcggataaccatcaccaacttctgcctcgggaagcatctggtgagcgagggggacctgctgaaggaccagagagggagccctgcctacatcagtcccgacgtgctcagcggccggccgtaccgtggcaagcccagtgacatgtgggccctggg
- Show more
|
Description: A cloning plasmid for the STK40 gene. |
STK40 cloning plasmid |
CSB-CL854027HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1308
- Sequence: atgaagcggagagcatcagacagaggagctggggaaacgtcggccagggccaaggctctaggaagtgggatttctggaaataatgcaaagagagctggaccattcatccttggtccccgtctgggcaactcaccggtgccaagcatagtgcagtgtttggcgaggaaagatggca
- Show more
|
Description: A cloning plasmid for the STK40 gene. |
Anti-STK40 (4G3) |
YF-MA11688 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to STK40 |
Serine/threonine Kinase 40 (STK40) Antibody |
abx145680-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serine/threonine Kinase 40 (STK40) Antibody |
abx034199-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Serine/threonine Kinase 40 (STK40) Antibody |
abx034199-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Serine/threonine Kinase 40 (STK40) Antibody |
20-abx214209 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine Kinase 40 (STK40) Antibody |
20-abx214607 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Mouse STK40 shRNA Plasmid |
20-abx978130 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat STK40 shRNA Plasmid |
20-abx990029 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human STK40 shRNA Plasmid |
20-abx963240 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
STK40 Recombinant Protein (Human) |
RP030442 |
ABM |
100 ug |
Ask for price |
STK40 Recombinant Protein (Human) |
RP030445 |
ABM |
100 ug |
Ask for price |
STK40 Recombinant Protein (Rat) |
RP231494 |
ABM |
100 ug |
Ask for price |
STK40 Recombinant Protein (Mouse) |
RP176108 |
ABM |
100 ug |
Ask for price |
STK40 Recombinant Protein (Mouse) |
RP176111 |
ABM |
100 ug |
Ask for price |
Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit |
E04S0412-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit |
E04S0412-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Serine/threonine protein kinase 40(STK40) ELISA kit |
E04S0412-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Serine/threonine protein kinase 40(STK40) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monoclonal STK40 Antibody (monoclonal) (M04), Clone: 4G3 |
AMM04153G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human STK40 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4G3. This antibody is applicable in WB and IHC |
h STK40 inducible lentiviral particles |
LVP202 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, STK40, is fully sequence verified and matched to NCBI accession ID: NM_032017 |
Stk40 ORF Vector (Mouse) (pORF) |
ORF058704 |
ABM |
1.0 ug DNA |
EUR 506 |
Stk40 ORF Vector (Mouse) (pORF) |
ORF058705 |
ABM |
1.0 ug DNA |
EUR 506 |
STK40 ORF Vector (Human) (pORF) |
ORF010148 |
ABM |
1.0 ug DNA |
EUR 95 |
STK40 ORF Vector (Human) (pORF) |
ORF010149 |
ABM |
1.0 ug DNA |
EUR 95 |
Stk40 ORF Vector (Rat) (pORF) |
ORF077166 |
ABM |
1.0 ug DNA |
EUR 506 |
STK40 sgRNA CRISPR Lentivector set (Human) |
K2304901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Stk40 sgRNA CRISPR Lentivector set (Mouse) |
K4693801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Stk40 sgRNA CRISPR Lentivector set (Rat) |
K6422301 |
ABM |
3 x 1.0 ug |
EUR 339 |
STK40 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2304902 |
ABM |
1.0 ug DNA |
EUR 154 |
STK40 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2304903 |
ABM |
1.0 ug DNA |
EUR 154 |
STK40 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2304904 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4693802 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4693803 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk40 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4693804 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk40 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6422302 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk40 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6422303 |
ABM |
1.0 ug DNA |
EUR 154 |
Stk40 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6422304 |
ABM |
1.0 ug DNA |
EUR 154 |
STK40 Protein Vector (Human) (pPB-C-His) |
PV040589 |
ABM |
500 ng |
EUR 329 |
STK40 Protein Vector (Human) (pPB-N-His) |
PV040590 |
ABM |
500 ng |
EUR 329 |
STK40 Protein Vector (Human) (pPM-C-HA) |
PV040591 |
ABM |
500 ng |
EUR 329 |
STK40 Protein Vector (Human) (pPM-C-His) |
PV040592 |
ABM |
500 ng |
EUR 329 |
STK40 Protein Vector (Human) (pPB-C-His) |
PV040593 |
ABM |
500 ng |
EUR 329 |
STK40 Protein Vector (Human) (pPB-N-His) |
PV040594 |
ABM |
500 ng |
EUR 329 |
STK40 Protein Vector (Human) (pPM-C-HA) |
PV040595 |
ABM |
500 ng |
EUR 329 |
STK40 Protein Vector (Human) (pPM-C-His) |
PV040596 |
ABM |
500 ng |
EUR 329 |
STK40 Protein Vector (Rat) (pPB-C-His) |
PV308662 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Rat) (pPB-N-His) |
PV308663 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Rat) (pPM-C-HA) |
PV308664 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Rat) (pPM-C-His) |
PV308665 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Mouse) (pPB-C-His) |
PV234814 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Mouse) (pPB-N-His) |
PV234815 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Mouse) (pPM-C-HA) |
PV234816 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Mouse) (pPM-C-His) |
PV234817 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Mouse) (pPB-C-His) |
PV234818 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Mouse) (pPB-N-His) |
PV234819 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Mouse) (pPM-C-HA) |
PV234820 |
ABM |
500 ng |
EUR 603 |
STK40 Protein Vector (Mouse) (pPM-C-His) |
PV234821 |
ABM |
500 ng |
EUR 603 |
Stk40 3'UTR GFP Stable Cell Line |
TU169860 |
ABM |
1.0 ml |
Ask for price |
Stk40 3'UTR Luciferase Stable Cell Line |
TU119860 |
ABM |
1.0 ml |
Ask for price |
STK40 3'UTR GFP Stable Cell Line |
TU074832 |
ABM |
1.0 ml |
EUR 2333 |
STK40 3'UTR Luciferase Stable Cell Line |
TU024832 |
ABM |
1.0 ml |
EUR 2333 |
Stk40 3'UTR Luciferase Stable Cell Line |
TU221326 |
ABM |
1.0 ml |
Ask for price |
Stk40 3'UTR GFP Stable Cell Line |
TU271326 |
ABM |
1.0 ml |
Ask for price |
STK40 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV665677 |
ABM |
1.0 ug DNA |
EUR 682 |
STK40 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV665681 |
ABM |
1.0 ug DNA |
EUR 682 |
STK40 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV665682 |
ABM |
1.0 ug DNA |
EUR 682 |
STK40 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV715521 |
ABM |
1.0 ug DNA |
EUR 316 |
STK40 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV715525 |
ABM |
1.0 ug DNA |
EUR 316 |
STK40 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV715526 |
ABM |
1.0 ug DNA |
EUR 316 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
STK40 Rabbit Polyclonal Antibody