TMC7 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

TMC7 Antibody
46286-100ul	SAB	100ul	EUR 252

TMC7 Antibody
46286-50ul	SAB	50ul	EUR 187

TMC7 Antibody
DF9975	Affbiotech	200ul	EUR 304
Description: TMC7 Antibody detects endogenous levels of total TMC7.

TMC7 antibody
70R-51400	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal TMC7 antibody

TMC7 Antibody
ABD9975	Lifescience Market	100 ug	EUR 438

TMC7 Conjugated Antibody
C46286	SAB	100ul	EUR 397

Anti-TMC7 antibody
STJ191553	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TMC7

TMC7 siRNA
20-abx936966	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMC7 siRNA
20-abx936967	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TMC7 Blocking Peptide
DF9975-BP	Affbiotech	1mg	EUR 195

TMC7 Blocking Peptide
20-abx064275	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

TMC7 cloning plasmid
CSB-CL773587HU-10ug	Cusabio	10ug	EUR 717
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2172 Sequence: atgagcgagtccagcggcagtgcgctccagcccggcaggcccagccggcagccggcggtccatccagagaacctctctctagactccagttgcttctcttctccacctgtgaacttcctccaagaattgccaagctaccggtccattgcacgtaggagaacgactgtccattcct Show more
Description: A cloning plasmid for the TMC7 gene.

pCMV-SPORT6-TMC7
PVT19121	Lifescience Market	2 ug	EUR 231

Mouse TMC7 shRNA Plasmid
20-abx980636	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TMC7 shRNA Plasmid
20-abx962656	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TMC7 Recombinant Protein (Rat)
RP233363	ABM	100 ug	Ask for price

TMC7 Recombinant Protein (Human)
RP031774	ABM	100 ug	Ask for price

TMC7 Recombinant Protein (Mouse)
RP179087	ABM	100 ug	Ask for price

Rabbit Transmembrane channel like protein 7(TMC7) ELISA kit
E04T0698-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transmembrane channel like protein 7(TMC7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transmembrane channel like protein 7(TMC7) ELISA kit
E04T0698-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transmembrane channel like protein 7(TMC7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transmembrane channel like protein 7(TMC7) ELISA kit
E04T0698-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Transmembrane channel like protein 7(TMC7) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Transmembrane Channel-Like Protein 7 (TMC7) Antibody
20-abx007758	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Transmembrane Channel-Like Protein 7 (TMC7) Antibody
20-abx219115	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Tmc7 ORF Vector (Rat) (pORF)
ORF077789	ABM	1.0 ug DNA	EUR 506

TMC7 ORF Vector (Human) (pORF)
ORF010592	ABM	1.0 ug DNA	EUR 95

Tmc7 ORF Vector (Mouse) (pORF)
ORF059697	ABM	1.0 ug DNA	EUR 506

Tmc7 sgRNA CRISPR Lentivector set (Rat)
K6183901	ABM	3 x 1.0 ug	EUR 339

Tmc7 sgRNA CRISPR Lentivector set (Mouse)
K4501501	ABM	3 x 1.0 ug	EUR 339

TMC7 sgRNA CRISPR Lentivector set (Human)
K2383601	ABM	3 x 1.0 ug	EUR 339

Tmc7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6183902	ABM	1.0 ug DNA	EUR 154

Tmc7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6183903	ABM	1.0 ug DNA	EUR 154

Tmc7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6183904	ABM	1.0 ug DNA	EUR 154

Tmc7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4501502	ABM	1.0 ug DNA	EUR 154

Tmc7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4501503	ABM	1.0 ug DNA	EUR 154

Tmc7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4501504	ABM	1.0 ug DNA	EUR 154

TMC7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2383602	ABM	1.0 ug DNA	EUR 154

TMC7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2383603	ABM	1.0 ug DNA	EUR 154

TMC7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2383604	ABM	1.0 ug DNA	EUR 154

TMC7 Protein Vector (Rat) (pPB-C-His)
PV311154	ABM	500 ng	EUR 1166

TMC7 Protein Vector (Rat) (pPB-N-His)
PV311155	ABM	500 ng	EUR 1166

TMC7 Protein Vector (Rat) (pPM-C-HA)
PV311156	ABM	500 ng	EUR 1166

TMC7 Protein Vector (Rat) (pPM-C-His)
PV311157	ABM	500 ng	EUR 1166

TMC7 Protein Vector (Mouse) (pPB-C-His)
PV238786	ABM	500 ng	EUR 1065

TMC7 Protein Vector (Mouse) (pPB-N-His)
PV238787	ABM	500 ng	EUR 1065

TMC7 Protein Vector (Mouse) (pPM-C-HA)
PV238788	ABM	500 ng	EUR 1065

TMC7 Protein Vector (Mouse) (pPM-C-His)
PV238789	ABM	500 ng	EUR 1065

TMC7 Protein Vector (Human) (pPB-C-His)
PV042365	ABM	500 ng	EUR 329

TMC7 Rabbit Polyclonal Antibody