TRPC7 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

TRPC7 Polyclonal Antibody
ES10258-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TRPC7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

TRPC7 Polyclonal Antibody
ABP60768-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein Applications tips:
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein

TRPC7 Polyclonal Antibody
ABP60768-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein Applications tips:
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein

TRPC7 Polyclonal Antibody
ABP60768-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein Applications tips:
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein

TRPC7 Rabbit pAb
A17738-100ul	Abclonal	100 ul	EUR 308

TRPC7 Rabbit pAb
A17738-200ul	Abclonal	200 ul	EUR 459

TRPC7 Rabbit pAb
A17738-20ul	Abclonal	20 ul	EUR 183

TRPC7 Rabbit pAb
A17738-50ul	Abclonal	50 ul	EUR 223

Polyclonal TRPC7 (extracellular) Antibody
AMM08351G	Leading Biology	0.05ml	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPC7 (extracellular) . This antibody is tested and proven to work in the following applications:

TRPC7 Antibody
35976-100ul	SAB	100ul	EUR 252

TRPC7 Antibody
1-CSB-PA954426	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TRPC7. Recognizes TRPC7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Polyclonal TRPC7 Antibody (internal region)
AMM08353G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRPC7 (internal region). This antibody is tested and proven to work in the following applications:

TRPC7
GT41031	Neuromics	100 ug	EUR 474

TRPC7 Conjugated Antibody
C35976	SAB	100ul	EUR 397

Anti-TRPC7 antibody
STJ71876	St John's Laboratory	100 µg	EUR 359

Anti-TRPC7 antibody
STJ119779	St John's Laboratory	100 µl	EUR 277

Anti-TRPC7 antibody
STJ191416	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to TRPC7

TRPC7 siRNA
20-abx938221	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TRPC7 siRNA
20-abx938222	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Monoclonal antibody for TrpC7
SMC-343D	Stressmarq	0.1mg	EUR 353
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is not conjugated.

Monoclonal antibody for TrpC7
SMC-343D-A390	Stressmarq	0.1mg	EUR 400
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 390.

Monoclonal antibody for TrpC7
SMC-343D-A488	Stressmarq	0.1mg	EUR 399
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 488.

Monoclonal antibody for TrpC7
SMC-343D-A565	Stressmarq	0.1mg	EUR 399
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 565.

Monoclonal antibody for TrpC7
SMC-343D-A594	Stressmarq	0.1mg	EUR 399
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 594.

Monoclonal antibody for TrpC7
SMC-343D-A633	Stressmarq	0.1mg	EUR 399
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 633.

Monoclonal antibody for TrpC7
SMC-343D-A655	Stressmarq	0.1mg	EUR 399
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 655.

Monoclonal antibody for TrpC7
SMC-343D-A680	Stressmarq	0.1mg	EUR 399
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 680.

Monoclonal antibody for TrpC7
SMC-343D-A700	Stressmarq	0.1mg	EUR 399
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 700.

Monoclonal antibody for TrpC7
SMC-343D-ALP	Stressmarq	0.1mg	EUR 393
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Alkaline Phosphatase.

Monoclonal antibody for TrpC7
SMC-343D-APC	Stressmarq	0.1mg	EUR 398
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with APC.

Monoclonal antibody for TrpC7
SMC-343D-APCCY7	Stressmarq	0.1mg	EUR 470
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with APC/Cy7.

Monoclonal antibody for TrpC7
SMC-343D-BI	Stressmarq	0.1mg	EUR 395
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Biotin.

Monoclonal antibody for TrpC7
SMC-343D-DY350	Stressmarq	0.1mg	EUR 413
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 350.

Monoclonal antibody for TrpC7
SMC-343D-DY405	Stressmarq	0.1mg	EUR 402
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 405.

Monoclonal antibody for TrpC7
SMC-343D-DY488	Stressmarq	0.1mg	EUR 392
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 488.

Monoclonal antibody for TrpC7
SMC-343D-DY594	Stressmarq	0.1mg	EUR 394
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 594.

Monoclonal antibody for TrpC7
SMC-343D-DY633	Stressmarq	0.1mg	EUR 389
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 633.

Monoclonal antibody for TrpC7
SMC-343D-FITC	Stressmarq	0.1mg	EUR 391
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with FITC.

Monoclonal antibody for TrpC7
SMC-343D-HRP	Stressmarq	0.1mg	EUR 387
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with HRP.

Monoclonal antibody for TrpC7
SMC-343D-P594	Stressmarq	0.1mg	EUR 406
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with PE/ATTO 594.

Monoclonal antibody for TrpC7
SMC-343D-PCP	Stressmarq	0.1mg	EUR 398
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with PerCP.

Monoclonal antibody for TrpC7
SMC-343D-RPE	Stressmarq	0.1mg	EUR 396
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with RPE.

Monoclonal antibody for TrpC7
SMC-343D-STR	Stressmarq	0.1mg	EUR 397
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Streptavidin.

Monoclonal antibody for TrpC7
SMC-343S	Stressmarq	0.012mg	EUR 65
Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular Show more
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is not conjugated.

TRPC7 cloning plasmid
CSB-CL888031HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2589 Sequence: ATGTTGAGGAACAGCACCTTCAAAAACATGCAGCGCCGGCACACAACGCTGAGGGAGAAGGGCCGTCGCCAGGCCATCCGGGGTCCCGCCTACATGTTCAACGAGAAGGGCACCAGTCTGACGCCCGAGGAGGAGCGCTTCCTGGACTCGGCTGAGTATGGCAACATCCCGGTGG Show more
Description: A cloning plasmid for the TRPC7 gene.

Anti-TRP 7/TRPC7 Antibody
PB9272	BosterBio	100ug/vial	EUR 294

Mouse TRPC7 shRNA Plasmid
20-abx973801	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human TRPC7 ELISA KIT
ELI-23166h	Lifescience Market	96 Tests	EUR 824

Mouse Trpc7 ELISA KIT
ELI-40252m	Lifescience Market	96 Tests	EUR 865

Human TRPC7 shRNA Plasmid
20-abx961329	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Trpc7 ORF Vector (Rat) (pORF)
ORF078288	ABM	1.0 ug DNA	EUR 506

TRPC7 ORF Vector (Human) (pORF)
ORF014834	ABM	1.0 ug DNA	EUR 354

Trpc7 ORF Vector (Mouse) (pORF)
ORF060511	ABM	1.0 ug DNA	EUR 506

TRPC7 sgRNA CRISPR Lentivector set (Human)
K2535801	ABM	3 x 1.0 ug	EUR 339

Trpc7 sgRNA CRISPR Lentivector set (Mouse)
K3756701	ABM	3 x 1.0 ug	EUR 339

Trpc7 sgRNA CRISPR Lentivector set (Rat)
K7338001	ABM	3 x 1.0 ug	EUR 339

TRPC7-AS1 ORF Vector (Human) (pORF)
ORF035167	ABM	1.0 ug DNA	Ask for price

TRPC7-AS2 ORF Vector (Human) (pORF)
ORF035168	ABM	1.0 ug DNA	Ask for price

TRPC7 sgRNA CRISPR Lentivector (Human) (Target 1)
K2535802	ABM	1.0 ug DNA	EUR 154

TRPC7 sgRNA CRISPR Lentivector (Human) (Target 2)
K2535803	ABM	1.0 ug DNA	EUR 154

TRPC7 sgRNA CRISPR Lentivector (Human) (Target 3)
K2535804	ABM	1.0 ug DNA	EUR 154

Trpc7 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3756702	ABM	1.0 ug DNA	EUR 154

Trpc7 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3756703	ABM	1.0 ug DNA	EUR 154

Trpc7 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3756704	ABM	1.0 ug DNA	EUR 154

Trpc7 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7338002	ABM	1.0 ug DNA	EUR 154

Trpc7 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7338003	ABM	1.0 ug DNA	EUR 154

Trpc7 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7338004	ABM	1.0 ug DNA	EUR 154

TRPC7 Protein Vector (Human) (pPB-C-His)
PV059333	ABM	500 ng	EUR 481

TRPC7 Protein Vector (Human) (pPB-N-His)
PV059334	ABM	500 ng	EUR 481

TRPC7 Protein Vector (Human) (pPM-C-HA)
PV059335	ABM	500 ng	EUR 481

TRPC7 Protein Vector (Human) (pPM-C-His)
PV059336	ABM	500 ng	EUR 481

TRPC7 Protein Vector (Rat) (pPB-C-His)
PV313150	ABM	500 ng	EUR 1166

TRPC7 Protein Vector (Rat) (pPB-N-His)
PV313151	ABM	500 ng	EUR 1166

TRPC7 Protein Vector (Rat) (pPM-C-HA)
PV313152	ABM	500 ng	EUR 1166

TRPC7 Protein Vector (Rat) (pPM-C-His)
PV313153	ABM	500 ng	EUR 1166

TRPC7 Protein Vector (Mouse) (pPB-C-His)
PV242042	ABM	500 ng	EUR 1065

TRPC7 Protein Vector (Mouse) (pPB-N-His)
PV242043	ABM	500 ng	EUR 1065

TRPC7 Protein Vector (Mouse) (pPM-C-HA)
PV242044	ABM	500 ng	EUR 1065

TRPC7 Protein Vector (Mouse) (pPM-C-His)
PV242045	ABM	500 ng	EUR 1065

Trpc7 3'UTR GFP Stable Cell Line
TU171184	ABM	1.0 ml	Ask for price

TRPC7 3'UTR GFP Stable Cell Line
TU077258	ABM	1.0 ml	EUR 1394

Trpc7 3'UTR Luciferase Stable Cell Line
TU121184	ABM	1.0 ml	Ask for price

TRPC7 3'UTR Luciferase Stable Cell Line
TU027258	ABM	1.0 ml	EUR 1394

Trpc7 3'UTR Luciferase Stable Cell Line
TU222504	ABM	1.0 ml	Ask for price

Trpc7 3'UTR GFP Stable Cell Line
TU272504	ABM	1.0 ml	Ask for price

TRPC7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV633367	ABM	1.0 ug DNA	EUR 1355

TRPC7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV633371	ABM	1.0 ug DNA	EUR 1355

TRPC7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV633372	ABM	1.0 ug DNA	EUR 1355

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Gab1 Rabbit Polyclonal Antibody
ES8582-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

TRPC7 Rabbit Polyclonal Antibody