TRPC7 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
TRPC7 Polyclonal Antibody |
ES10258-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against TRPC7 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
TRPC7 Polyclonal Antibody |
ABP60768-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein |
TRPC7 Polyclonal Antibody |
ABP60768-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein |
TRPC7 Polyclonal Antibody |
ABP60768-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human TRPC7 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of TRPC7 from Human, Mouse. This TRPC7 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TRPC7 protein |
TRPC7 Rabbit pAb |
A17738-100ul |
Abclonal |
100 ul |
EUR 308 |
TRPC7 Rabbit pAb |
A17738-200ul |
Abclonal |
200 ul |
EUR 459 |
TRPC7 Rabbit pAb |
A17738-20ul |
Abclonal |
20 ul |
EUR 183 |
TRPC7 Rabbit pAb |
A17738-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal TRPC7 (extracellular) Antibody |
AMM08351G |
Leading Biology |
0.05ml |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRPC7 (extracellular) . This antibody is tested and proven to work in the following applications: |
TRPC7 Antibody |
35976-100ul |
SAB |
100ul |
EUR 252 |
TRPC7 Antibody |
1-CSB-PA954426 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against TRPC7. Recognizes TRPC7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
Polyclonal TRPC7 Antibody (internal region) |
AMM08353G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TRPC7 (internal region). This antibody is tested and proven to work in the following applications: |
TRPC7 Conjugated Antibody |
C35976 |
SAB |
100ul |
EUR 397 |
Anti-TRPC7 antibody |
STJ191416 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to TRPC7 |
TRPC7 siRNA |
20-abx938221 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TRPC7 siRNA |
20-abx938222 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Monoclonal antibody for TrpC7 |
SMC-343D |
Stressmarq |
0.1mg |
EUR 353 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is not conjugated. |
Monoclonal antibody for TrpC7 |
SMC-343D-A390 |
Stressmarq |
0.1mg |
EUR 400 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 390. |
Monoclonal antibody for TrpC7 |
SMC-343D-A488 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 488. |
Monoclonal antibody for TrpC7 |
SMC-343D-A565 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 565. |
Monoclonal antibody for TrpC7 |
SMC-343D-A594 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 594. |
Monoclonal antibody for TrpC7 |
SMC-343D-A633 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 633. |
Monoclonal antibody for TrpC7 |
SMC-343D-A655 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 655. |
Monoclonal antibody for TrpC7 |
SMC-343D-A680 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 680. |
Monoclonal antibody for TrpC7 |
SMC-343D-A700 |
Stressmarq |
0.1mg |
EUR 399 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with ATTO 700. |
Monoclonal antibody for TrpC7 |
SMC-343D-ALP |
Stressmarq |
0.1mg |
EUR 393 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Alkaline Phosphatase. |
Monoclonal antibody for TrpC7 |
SMC-343D-APC |
Stressmarq |
0.1mg |
EUR 398 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with APC. |
Monoclonal antibody for TrpC7 |
SMC-343D-APCCY7 |
Stressmarq |
0.1mg |
EUR 470 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with APC/Cy7. |
Monoclonal antibody for TrpC7 |
SMC-343D-BI |
Stressmarq |
0.1mg |
EUR 395 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Biotin. |
Monoclonal antibody for TrpC7 |
SMC-343D-DY350 |
Stressmarq |
0.1mg |
EUR 413 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 350. |
Monoclonal antibody for TrpC7 |
SMC-343D-DY405 |
Stressmarq |
0.1mg |
EUR 402 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 405. |
Monoclonal antibody for TrpC7 |
SMC-343D-DY488 |
Stressmarq |
0.1mg |
EUR 392 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 488. |
Monoclonal antibody for TrpC7 |
SMC-343D-DY594 |
Stressmarq |
0.1mg |
EUR 394 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 594. |
Monoclonal antibody for TrpC7 |
SMC-343D-DY633 |
Stressmarq |
0.1mg |
EUR 389 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Dylight 633. |
Monoclonal antibody for TrpC7 |
SMC-343D-FITC |
Stressmarq |
0.1mg |
EUR 391 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with FITC. |
Monoclonal antibody for TrpC7 |
SMC-343D-HRP |
Stressmarq |
0.1mg |
EUR 387 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with HRP. |
Monoclonal antibody for TrpC7 |
SMC-343D-P594 |
Stressmarq |
0.1mg |
EUR 406 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human | Rat TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with PE/ATTO 594. |
Monoclonal antibody for TrpC7 |
SMC-343D-PCP |
Stressmarq |
0.1mg |
EUR 398 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with PerCP. |
Monoclonal antibody for TrpC7 |
SMC-343D-RPE |
Stressmarq |
0.1mg |
EUR 396 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with RPE. |
Monoclonal antibody for TrpC7 |
SMC-343D-STR |
Stressmarq |
0.1mg |
EUR 397 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is conjugated with Streptavidin. |
Monoclonal antibody for TrpC7 |
SMC-343S |
Stressmarq |
0.012mg |
EUR 65 |
- Transient receptor potential cation channel, subfamily C, member 7, also known as TRPC7, is a non-selective cation channel that is directly activated by DAG. TrpC7 shows constitutive activity and susceptibility to negative regulation by extracellular
- Show more
|
Description: A monoclonal antibody from clone S64A-36 against Human TrpC7. The host species for the production of this antibody is Mouse. The antigen used for immunization is Human Synthetic peptide amino acids 845-862 of human TRPC7. The antibody is tested and validated for WB, IHC, ICC/IF, IP, AM assays with the following recommended dilutions: WB (1:1000), IHC (1:1000), ICC/IF (1:100). This MAb for TrpC7 is not conjugated. |
TRPC7 cloning plasmid |
CSB-CL888031HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2589
- Sequence: ATGTTGAGGAACAGCACCTTCAAAAACATGCAGCGCCGGCACACAACGCTGAGGGAGAAGGGCCGTCGCCAGGCCATCCGGGGTCCCGCCTACATGTTCAACGAGAAGGGCACCAGTCTGACGCCCGAGGAGGAGCGCTTCCTGGACTCGGCTGAGTATGGCAACATCCCGGTGG
- Show more
|
Description: A cloning plasmid for the TRPC7 gene. |
Anti-TRP 7/TRPC7 Antibody |
PB9272 |
BosterBio |
100ug/vial |
EUR 294 |
Mouse TRPC7 shRNA Plasmid |
20-abx973801 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human TRPC7 shRNA Plasmid |
20-abx961329 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Trpc7 ORF Vector (Rat) (pORF) |
ORF078288 |
ABM |
1.0 ug DNA |
EUR 506 |
TRPC7 ORF Vector (Human) (pORF) |
ORF014834 |
ABM |
1.0 ug DNA |
EUR 354 |
Trpc7 ORF Vector (Mouse) (pORF) |
ORF060511 |
ABM |
1.0 ug DNA |
EUR 506 |
TRPC7 sgRNA CRISPR Lentivector set (Human) |
K2535801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Trpc7 sgRNA CRISPR Lentivector set (Mouse) |
K3756701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Trpc7 sgRNA CRISPR Lentivector set (Rat) |
K7338001 |
ABM |
3 x 1.0 ug |
EUR 339 |
TRPC7-AS1 ORF Vector (Human) (pORF) |
ORF035167 |
ABM |
1.0 ug DNA |
Ask for price |
TRPC7-AS2 ORF Vector (Human) (pORF) |
ORF035168 |
ABM |
1.0 ug DNA |
Ask for price |
TRPC7 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2535802 |
ABM |
1.0 ug DNA |
EUR 154 |
TRPC7 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2535803 |
ABM |
1.0 ug DNA |
EUR 154 |
TRPC7 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2535804 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpc7 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3756702 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpc7 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3756703 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpc7 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3756704 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpc7 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7338002 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpc7 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7338003 |
ABM |
1.0 ug DNA |
EUR 154 |
Trpc7 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7338004 |
ABM |
1.0 ug DNA |
EUR 154 |
TRPC7 Protein Vector (Human) (pPB-C-His) |
PV059333 |
ABM |
500 ng |
EUR 481 |
TRPC7 Protein Vector (Human) (pPB-N-His) |
PV059334 |
ABM |
500 ng |
EUR 481 |
TRPC7 Protein Vector (Human) (pPM-C-HA) |
PV059335 |
ABM |
500 ng |
EUR 481 |
TRPC7 Protein Vector (Human) (pPM-C-His) |
PV059336 |
ABM |
500 ng |
EUR 481 |
TRPC7 Protein Vector (Rat) (pPB-C-His) |
PV313150 |
ABM |
500 ng |
EUR 1166 |
TRPC7 Protein Vector (Rat) (pPB-N-His) |
PV313151 |
ABM |
500 ng |
EUR 1166 |
TRPC7 Protein Vector (Rat) (pPM-C-HA) |
PV313152 |
ABM |
500 ng |
EUR 1166 |
TRPC7 Protein Vector (Rat) (pPM-C-His) |
PV313153 |
ABM |
500 ng |
EUR 1166 |
TRPC7 Protein Vector (Mouse) (pPB-C-His) |
PV242042 |
ABM |
500 ng |
EUR 1065 |
TRPC7 Protein Vector (Mouse) (pPB-N-His) |
PV242043 |
ABM |
500 ng |
EUR 1065 |
TRPC7 Protein Vector (Mouse) (pPM-C-HA) |
PV242044 |
ABM |
500 ng |
EUR 1065 |
TRPC7 Protein Vector (Mouse) (pPM-C-His) |
PV242045 |
ABM |
500 ng |
EUR 1065 |
Trpc7 3'UTR GFP Stable Cell Line |
TU171184 |
ABM |
1.0 ml |
Ask for price |
TRPC7 3'UTR GFP Stable Cell Line |
TU077258 |
ABM |
1.0 ml |
EUR 1394 |
Trpc7 3'UTR Luciferase Stable Cell Line |
TU121184 |
ABM |
1.0 ml |
Ask for price |
TRPC7 3'UTR Luciferase Stable Cell Line |
TU027258 |
ABM |
1.0 ml |
EUR 1394 |
Trpc7 3'UTR Luciferase Stable Cell Line |
TU222504 |
ABM |
1.0 ml |
Ask for price |
Trpc7 3'UTR GFP Stable Cell Line |
TU272504 |
ABM |
1.0 ml |
Ask for price |
TRPC7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV633367 |
ABM |
1.0 ug DNA |
EUR 1355 |
TRPC7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV633371 |
ABM |
1.0 ug DNA |
EUR 1355 |
TRPC7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV633372 |
ABM |
1.0 ug DNA |
EUR 1355 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
TRPC7 Rabbit Polyclonal Antibody