ULK4 Rabbit Polyclonal Antibody

Order Now: info@ifarai.org

ULK4 Polyclonal Antibody
ABP60854-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human ULK4 protein Applications tips:
Description: A polyclonal antibody for detection of ULK4 from Human, Mouse. This ULK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ULK4 protein

ULK4 Polyclonal Antibody
ABP60854-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ULK4 protein Applications tips:
Description: A polyclonal antibody for detection of ULK4 from Human, Mouse. This ULK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ULK4 protein

ULK4 Polyclonal Antibody
ABP60854-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ULK4 protein Applications tips:
Description: A polyclonal antibody for detection of ULK4 from Human, Mouse. This ULK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ULK4 protein

ULK4 Polyclonal Antibody
ES10217-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ULK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ULK4 Polyclonal Antibody
ES10217-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ULK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

ULK4 Rabbit pAb
A7471-100ul	Abclonal	100 ul	EUR 308

ULK4 Rabbit pAb
A7471-200ul	Abclonal	200 ul	EUR 459

ULK4 Rabbit pAb
A7471-20ul	Abclonal	20 ul	EUR 183

ULK4 Rabbit pAb
A7471-50ul	Abclonal	50 ul	EUR 223

ULK4 Antibody
43614-100ul	SAB	100ul	EUR 252

ULK4 Antibody
1-CSB-PA853394ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ULK4. Recognizes ULK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ULK4 Antibody
1-CSB-PA853394ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ULK4. Recognizes ULK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ULK4 Antibody
DF9891	Affbiotech	200ul	EUR 304
Description: ULK4 Antibody detects endogenous levels of total ULK4.

ULK4 Antibody
ABD9891	Lifescience Market	100 ug	EUR 438

Polyclonal ULK4 Antibody (C-Terminus)
AMM08433G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ULK4 (C-Terminus). This antibody is tested and proven to work in the following applications:

Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody
20-abx006976	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody
abx122774-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody
20-abx320936	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody
20-abx320937	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

ULK4 Conjugated Antibody
C43614	SAB	100ul	EUR 397

Anti-ULK4 antibody
STJ29607	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15.

Anti-ULK4 antibody
STJ191375	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ULK4

Anti-ULK4 Antibody
STJ503470	St John's Laboratory	100 µg	EUR 476

ULK4 siRNA
20-abx939011	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ULK4 siRNA
20-abx939012	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-ULK4
YF-PA19493	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to ULK4

anti-ULK4
YF-PA19494	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to ULK4

Anti-ULK4 Antibody (Biotin)
STJ503471	St John's Laboratory	100 µg	EUR 586

Anti-ULK4 Antibody (FITC)
STJ503472	St John's Laboratory	100 µg	EUR 586

ULK4 Blocking Peptide
DF9891-BP	Affbiotech	1mg	EUR 195

ULK4 cloning plasmid
CSB-CL853394HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1743 Sequence: atggaaaactttattctgtatgaggagatcggaagaggaagcaagactgttgtctataaagggcgacggaagggaacaatcaattttgtagccattctttgtactgataagtgcaaaaggcctgaaataaccaactgggtccgtctcacccgtgaaataaaacacaagaatattg Show more
Description: A cloning plasmid for the ULK4 gene.

pCMV-SPORT6-ULK4
PVT13821	Lifescience Market	2 ug	EUR 391

Mouse Serine/threonine- protein kinase ULK4, Ulk4 ELISA KIT
ELI-51201m	Lifescience Market	96 Tests	EUR 865

Human Serine/threonine- protein kinase ULK4, ULK4 ELISA KIT
ELI-44741h	Lifescience Market	96 Tests	EUR 824

Human ULK4 shRNA Plasmid
20-abx960382	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse ULK4 shRNA Plasmid
20-abx980592	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Anti-ULK4 (4A10-1A7)
YF-MA18713	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ULK4

Ulk4 ORF Vector (Mouse) (pORF)
ORF061031	ABM	1.0 ug DNA	EUR 506

h ULK4 inducible lentiviral particles
LVP164	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, ULK4 , is fully sequence verified and matched to NCBI accession ID: NM_017886.2

ULK4 ORF Vector (Human) (pORF)
ORF011322	ABM	1.0 ug DNA	EUR 95

Monoclonal ULK4 Antibody (monoclonal) (M01), Clone: 4A10-1A7
AMM08434G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human ULK4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A10-1A7. This antibody is applicable in WB, E

Ulk4 sgRNA CRISPR Lentivector set (Mouse)
K3603101	ABM	3 x 1.0 ug	EUR 339

ULK4 sgRNA CRISPR Lentivector set (Human)
K2587701	ABM	3 x 1.0 ug	EUR 339

ULK4-IT1 ORF Vector (Human) (pORF)
ORF035491	ABM	1.0 ug DNA	Ask for price

Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3603102	ABM	1.0 ug DNA	EUR 154

Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3603103	ABM	1.0 ug DNA	EUR 154

Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3603104	ABM	1.0 ug DNA	EUR 154

ULK4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2587702	ABM	1.0 ug DNA	EUR 154

ULK4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2587703	ABM	1.0 ug DNA	EUR 154

ULK4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2587704	ABM	1.0 ug DNA	EUR 154

ULK4 Protein Vector (Mouse) (pPB-C-His)
PV244122	ABM	500 ng	EUR 1065

ULK4 Protein Vector (Mouse) (pPB-N-His)
PV244123	ABM	500 ng	EUR 1065

ULK4 Protein Vector (Mouse) (pPM-C-HA)
PV244124	ABM	500 ng	EUR 1065

ULK4 Protein Vector (Mouse) (pPM-C-His)
PV244125	ABM	500 ng	EUR 1065

ULK4 Protein Vector (Human) (pPB-C-His)
PV045285	ABM	500 ng	EUR 329

ULK4 Protein Vector (Human) (pPB-N-His)
PV045286	ABM	500 ng	EUR 329

ULK4 Protein Vector (Human) (pPM-C-HA)
PV045287	ABM	500 ng	EUR 329

ULK4 Protein Vector (Human) (pPM-C-His)
PV045288	ABM	500 ng	EUR 329

Ulk4 3'UTR Luciferase Stable Cell Line
TU121577	ABM	1.0 ml	Ask for price

ULK4 3'UTR GFP Stable Cell Line
TU077824	ABM	1.0 ml	EUR 1394

Ulk4 3'UTR GFP Stable Cell Line
TU171577	ABM	1.0 ml	Ask for price

ULK4 3'UTR Luciferase Stable Cell Line
TU027824	ABM	1.0 ml	EUR 1394

ULK4-IT1 Protein Vector (Human) (pPB-C-His)
PV141962	ABM	500 ng	Ask for price

ULK4-IT1 Protein Vector (Human) (pPB-N-His)
PV141963	ABM	500 ng	Ask for price

ULK4-IT1 Protein Vector (Human) (pPM-C-HA)
PV141964	ABM	500 ng	Ask for price

ULK4-IT1 Protein Vector (Human) (pPM-C-His)
PV141965	ABM	500 ng	Ask for price

ULK4-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV755189	ABM	1.0 ug DNA	Ask for price

ULK4-IT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV755193	ABM	1.0 ug DNA	Ask for price

ULK4-IT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV755194	ABM	1.0 ug DNA	Ask for price

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of CD10 of MME Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

ULK4 Rabbit Polyclonal Antibody