ULK4 Rabbit Polyclonal Antibody
Order Now: info@ifarai.org
ULK4 Polyclonal Antibody |
ABP60854-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human ULK4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ULK4 from Human, Mouse. This ULK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ULK4 protein |
ULK4 Polyclonal Antibody |
ABP60854-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ULK4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ULK4 from Human, Mouse. This ULK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ULK4 protein |
ULK4 Polyclonal Antibody |
ABP60854-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ULK4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of ULK4 from Human, Mouse. This ULK4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ULK4 protein |
ULK4 Polyclonal Antibody |
ES10217-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ULK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ULK4 Polyclonal Antibody |
ES10217-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ULK4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ULK4 Rabbit pAb |
A7471-100ul |
Abclonal |
100 ul |
EUR 308 |
ULK4 Rabbit pAb |
A7471-200ul |
Abclonal |
200 ul |
EUR 459 |
ULK4 Rabbit pAb |
A7471-20ul |
Abclonal |
20 ul |
EUR 183 |
ULK4 Rabbit pAb |
A7471-50ul |
Abclonal |
50 ul |
EUR 223 |
ULK4 Antibody |
43614-100ul |
SAB |
100ul |
EUR 252 |
ULK4 Antibody |
1-CSB-PA853394ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ULK4. Recognizes ULK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ULK4 Antibody |
1-CSB-PA853394ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against ULK4. Recognizes ULK4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ULK4 Antibody |
DF9891 |
Affbiotech |
200ul |
EUR 304 |
Description: ULK4 Antibody detects endogenous levels of total ULK4. |
Polyclonal ULK4 Antibody (C-Terminus) |
AMM08433G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ULK4 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody |
20-abx006976 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody |
abx122774-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody |
20-abx320936 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase ULK4 (ULK4) Antibody |
20-abx320937 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ULK4 Conjugated Antibody |
C43614 |
SAB |
100ul |
EUR 397 |
Anti-ULK4 antibody |
STJ29607 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. |
Anti-ULK4 antibody |
STJ191375 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to ULK4 |
ULK4 siRNA |
20-abx939011 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ULK4 siRNA |
20-abx939012 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ULK4 |
YF-PA19493 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to ULK4 |
anti-ULK4 |
YF-PA19494 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to ULK4 |
ULK4 Blocking Peptide |
DF9891-BP |
Affbiotech |
1mg |
EUR 195 |
ULK4 cloning plasmid |
CSB-CL853394HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1743
- Sequence: atggaaaactttattctgtatgaggagatcggaagaggaagcaagactgttgtctataaagggcgacggaagggaacaatcaattttgtagccattctttgtactgataagtgcaaaaggcctgaaataaccaactgggtccgtctcacccgtgaaataaaacacaagaatattg
- Show more
|
Description: A cloning plasmid for the ULK4 gene. |
Mouse Serine/threonine- protein kinase ULK4, Ulk4 ELISA KIT |
ELI-51201m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Serine/threonine- protein kinase ULK4, ULK4 ELISA KIT |
ELI-44741h |
Lifescience Market |
96 Tests |
EUR 824 |
Human ULK4 shRNA Plasmid |
20-abx960382 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse ULK4 shRNA Plasmid |
20-abx980592 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-ULK4 (4A10-1A7) |
YF-MA18713 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to ULK4 |
Ulk4 ORF Vector (Mouse) (pORF) |
ORF061031 |
ABM |
1.0 ug DNA |
EUR 506 |
h ULK4 inducible lentiviral particles |
LVP164 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, ULK4 , is fully sequence verified and matched to NCBI accession ID: NM_017886.2 |
ULK4 ORF Vector (Human) (pORF) |
ORF011322 |
ABM |
1.0 ug DNA |
EUR 95 |
Monoclonal ULK4 Antibody (monoclonal) (M01), Clone: 4A10-1A7 |
AMM08434G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human ULK4 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A10-1A7. This antibody is applicable in WB, E |
Ulk4 sgRNA CRISPR Lentivector set (Mouse) |
K3603101 |
ABM |
3 x 1.0 ug |
EUR 339 |
ULK4 sgRNA CRISPR Lentivector set (Human) |
K2587701 |
ABM |
3 x 1.0 ug |
EUR 339 |
ULK4-IT1 ORF Vector (Human) (pORF) |
ORF035491 |
ABM |
1.0 ug DNA |
Ask for price |
Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3603102 |
ABM |
1.0 ug DNA |
EUR 154 |
Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3603103 |
ABM |
1.0 ug DNA |
EUR 154 |
Ulk4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3603104 |
ABM |
1.0 ug DNA |
EUR 154 |
ULK4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2587702 |
ABM |
1.0 ug DNA |
EUR 154 |
ULK4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K2587703 |
ABM |
1.0 ug DNA |
EUR 154 |
ULK4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2587704 |
ABM |
1.0 ug DNA |
EUR 154 |
ULK4 Protein Vector (Mouse) (pPB-C-His) |
PV244122 |
ABM |
500 ng |
EUR 1065 |
ULK4 Protein Vector (Mouse) (pPB-N-His) |
PV244123 |
ABM |
500 ng |
EUR 1065 |
ULK4 Protein Vector (Mouse) (pPM-C-HA) |
PV244124 |
ABM |
500 ng |
EUR 1065 |
ULK4 Protein Vector (Mouse) (pPM-C-His) |
PV244125 |
ABM |
500 ng |
EUR 1065 |
ULK4 Protein Vector (Human) (pPB-C-His) |
PV045285 |
ABM |
500 ng |
EUR 329 |
ULK4 Protein Vector (Human) (pPB-N-His) |
PV045286 |
ABM |
500 ng |
EUR 329 |
ULK4 Protein Vector (Human) (pPM-C-HA) |
PV045287 |
ABM |
500 ng |
EUR 329 |
ULK4 Protein Vector (Human) (pPM-C-His) |
PV045288 |
ABM |
500 ng |
EUR 329 |
Ulk4 3'UTR Luciferase Stable Cell Line |
TU121577 |
ABM |
1.0 ml |
Ask for price |
ULK4 3'UTR GFP Stable Cell Line |
TU077824 |
ABM |
1.0 ml |
EUR 1394 |
Ulk4 3'UTR GFP Stable Cell Line |
TU171577 |
ABM |
1.0 ml |
Ask for price |
ULK4 3'UTR Luciferase Stable Cell Line |
TU027824 |
ABM |
1.0 ml |
EUR 1394 |
ULK4-IT1 Protein Vector (Human) (pPB-C-His) |
PV141962 |
ABM |
500 ng |
Ask for price |
ULK4-IT1 Protein Vector (Human) (pPB-N-His) |
PV141963 |
ABM |
500 ng |
Ask for price |
ULK4-IT1 Protein Vector (Human) (pPM-C-HA) |
PV141964 |
ABM |
500 ng |
Ask for price |
ULK4-IT1 Protein Vector (Human) (pPM-C-His) |
PV141965 |
ABM |
500 ng |
Ask for price |
ULK4-IT1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV755189 |
ABM |
1.0 ug DNA |
Ask for price |
ULK4-IT1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV755193 |
ABM |
1.0 ug DNA |
Ask for price |
ULK4-IT1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV755194 |
ABM |
1.0 ug DNA |
Ask for price |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
ULK4 Rabbit Polyclonal Antibody